ID: 1123841782

View in Genome Browser
Species Human (GRCh38)
Location 15:24254613-24254635
Sequence CACAATGCTGATAGTGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123841782_1123841784 3 Left 1123841782 15:24254613-24254635 CCCATGTCACTATCAGCATTGTG No data
Right 1123841784 15:24254639-24254661 ACAACAATTTAACCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123841782 Original CRISPR CACAATGCTGATAGTGACAT GGG (reversed) Intergenic
No off target data available for this crispr