ID: 1123845647

View in Genome Browser
Species Human (GRCh38)
Location 15:24298456-24298478
Sequence TTTATAGAAGGTCTGTCCAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123845647_1123845649 18 Left 1123845647 15:24298456-24298478 CCTATGGACAGACCTTCTATAAA No data
Right 1123845649 15:24298497-24298519 AAAAAATATTTAACATTCTTTGG No data
1123845647_1123845650 19 Left 1123845647 15:24298456-24298478 CCTATGGACAGACCTTCTATAAA No data
Right 1123845650 15:24298498-24298520 AAAAATATTTAACATTCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123845647 Original CRISPR TTTATAGAAGGTCTGTCCAT AGG (reversed) Intergenic
No off target data available for this crispr