ID: 1123849956

View in Genome Browser
Species Human (GRCh38)
Location 15:24344306-24344328
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1250
Summary {0: 70, 1: 178, 2: 280, 3: 215, 4: 507}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123849956_1123849966 28 Left 1123849956 15:24344306-24344328 CCCACTTTTAATTACATGCAAAT 0: 70
1: 178
2: 280
3: 215
4: 507
Right 1123849966 15:24344357-24344379 GGAAAGGGGCAGTGACTTCTAGG No data
1123849956_1123849962 7 Left 1123849956 15:24344306-24344328 CCCACTTTTAATTACATGCAAAT 0: 70
1: 178
2: 280
3: 215
4: 507
Right 1123849962 15:24344336-24344358 CAGTCAATGCAAATTGAGGCAGG No data
1123849956_1123849963 12 Left 1123849956 15:24344306-24344328 CCCACTTTTAATTACATGCAAAT 0: 70
1: 178
2: 280
3: 215
4: 507
Right 1123849963 15:24344341-24344363 AATGCAAATTGAGGCAGGAAAGG No data
1123849956_1123849964 13 Left 1123849956 15:24344306-24344328 CCCACTTTTAATTACATGCAAAT 0: 70
1: 178
2: 280
3: 215
4: 507
Right 1123849964 15:24344342-24344364 ATGCAAATTGAGGCAGGAAAGGG No data
1123849956_1123849965 14 Left 1123849956 15:24344306-24344328 CCCACTTTTAATTACATGCAAAT 0: 70
1: 178
2: 280
3: 215
4: 507
Right 1123849965 15:24344343-24344365 TGCAAATTGAGGCAGGAAAGGGG No data
1123849956_1123849961 3 Left 1123849956 15:24344306-24344328 CCCACTTTTAATTACATGCAAAT 0: 70
1: 178
2: 280
3: 215
4: 507
Right 1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123849956 Original CRISPR ATTTGCATGTAATTAAAAGT GGG (reversed) Intergenic
900378039 1:2368372-2368394 ATCTGCACGCAGTTAAAAGTGGG - Intronic
900688620 1:3965730-3965752 ATTTGCATGTCATTAAAAGCAGG + Intergenic
900737097 1:4305816-4305838 ATTTGCATGTAACTAACAGTGGG - Intergenic
900787852 1:4659964-4659986 ATCTCCGTGGAATTAAAAGTAGG + Intronic
901552151 1:10003475-10003497 CTCTGCATGTAACTAGAAGTGGG + Intronic
901779195 1:11581759-11581781 ATCTGCATATAATTAGATGTGGG + Intergenic
902153397 1:14463078-14463100 ATTTGCATGTAATTAAAAGTGGG - Intergenic
902154573 1:14474197-14474219 ATTTGCATGTACTAGAAAATAGG - Intergenic
902259943 1:15217347-15217369 TTTTGCACATAATTGAAAGTGGG + Intronic
902260124 1:15218861-15218883 ATTTGCATGTGACTAAAAGTGGG + Intronic
902638819 1:17753064-17753086 ATCTCCATGTAATTAAACATGGG + Intergenic
902714077 1:18260555-18260577 ATTTGCATGTAATTGAAAGTGGG - Intronic
902714247 1:18261551-18261573 ATTTGCATGTAATTAAAAGTGGG + Intronic
902749066 1:18494082-18494104 ATTTGCATGTAATTAAAAGTGGG - Intergenic
902959904 1:19955894-19955916 ATTAGCATGTCATTCAAAGTGGG + Intergenic
902966516 1:20008519-20008541 ATTTACATGTGGTTAAAAGTGGG - Intergenic
903103061 1:21050191-21050213 ATTTCCTTGTGGTTAAAAGTTGG - Intronic
903824414 1:26132785-26132807 ATTTGCATATAATTAAAAGTGGG + Intergenic
904089989 1:27938026-27938048 ATCTCCAGGCAATTAAAAGTGGG + Intronic
904347652 1:29883740-29883762 ATCTGCATGCAGTTAAAAGTGGG + Intergenic
904348555 1:29890111-29890133 ATCTGCATGTCATTAAAAGTGGG + Intergenic
904407840 1:30305042-30305064 ATTTGCATGTAATTAAAAGTGGG + Intergenic
904420652 1:30388987-30389009 ATTTGCATTAAATTAGAAGGTGG - Intergenic
904455986 1:30648438-30648460 ATTTGCATATAATTAAAATTGGG - Intergenic
904718354 1:32486507-32486529 ATTTGCATGTAACTAAAAGTGGG - Exonic
905039034 1:34937950-34937972 ATTTGCATATAATTAAAAGTAGG + Intergenic
905764945 1:40592526-40592548 ATTTGTGTGTAATTGAAAGTAGG + Intergenic
906112928 1:43336650-43336672 GTTTGAATGTAACTTAAAGTTGG - Intergenic
906112974 1:43336978-43337000 GTTTGAATGTAACTTAAAGTTGG - Intergenic
906182400 1:43833561-43833583 ATTTGCACATCTTTAAAAGTGGG - Intronic
906217286 1:44050484-44050506 ATTTGCATGTACTTAAAAGTGGG + Intergenic
906218877 1:44061609-44061631 ATTTGCATGTAATTAAAAATGGG + Intergenic
906234418 1:44195897-44195919 ATTTGCATGTAATCGAAAGTGGG + Intergenic
906425080 1:45704963-45704985 ATTTGCACATAATTAAAAGTAGG + Intronic
906499877 1:46333847-46333869 ATTTGCATCTAATTAAAAGTGGG + Intergenic
906578279 1:46910859-46910881 ATCTGCATGCAATTAAAAGTGGG - Intergenic
906978990 1:50608107-50608129 ATTTGCATGTAATTAAAAGCAGG - Intronic
907002296 1:50873688-50873710 ATTTGCATGTAATTAAAAGTGGG + Intronic
907026414 1:51124608-51124630 ATTTGCATGTAATTGAATGTGGG - Intronic
907372010 1:54009889-54009911 ATTTGTATGTAAGTAAATGGAGG - Intronic
907652644 1:56310457-56310479 ATCTGCATGCAATTAAAAGTGGG - Intergenic
908038192 1:60078878-60078900 ATTTGCATTCTATTTAAAGTCGG - Intergenic
908297542 1:62728098-62728120 ATCTGCATACAATTAAAAGTGGG - Intergenic
908934281 1:69355938-69355960 ATTTGTATATAATTAAAAGTAGG - Intergenic
909881048 1:80879161-80879183 ATTTCCAGATTATTAAAAGTTGG - Intergenic
910035462 1:82782702-82782724 ATTTGCATGTAATTAAAAGTAGG + Intergenic
910196739 1:84649621-84649643 CTTTGCTCTTAATTAAAAGTAGG - Intronic
910479049 1:87638599-87638621 ATTTGCATATACTTAAAAATGGG + Intergenic
910531396 1:88239989-88240011 ATTAGCATGTAAGTATAAATGGG - Intergenic
911409804 1:97488842-97488864 ATTTGGATGTAATCAAAAGTGGG + Intronic
911419989 1:97628744-97628766 ATTTGCATATAATGAAGAGGTGG - Intronic
911712529 1:101091154-101091176 ATTTGTAAGTAACTTAAAGTAGG - Intergenic
911732331 1:101304163-101304185 ATTTGCATGTAATTAAAAGTGGG + Intergenic
911937956 1:104004715-104004737 ATTTGCATATAATTAAAAGTGGG + Intergenic
911959174 1:104277888-104277910 ATTTGCATGTAATTGGCACTAGG - Intergenic
912043829 1:105427834-105427856 TTTTGCATGTAATTGAAAGTAGG - Intergenic
912054903 1:105582696-105582718 TTTTGTATGTAATGAAAAGTGGG + Intergenic
912160545 1:106979355-106979377 ATTTGCATCTAAATAAAATATGG + Intergenic
912971401 1:114287046-114287068 CTTTGCATATAATTGAAAGTGGG - Intergenic
913399697 1:118417131-118417153 ATTTGCATATATATAAAACTTGG + Intergenic
913658184 1:120981806-120981828 ATTGGCATGTAATTAAAAGTGGG - Intergenic
914009540 1:143764875-143764897 ATTGGCATGTAATTAAAAGTGGG - Intergenic
914415545 1:147477986-147478008 TTTTGCATGTAATTTCAAGAAGG - Intergenic
914648165 1:149673550-149673572 ATTGGCATGTAATTAAAAGTGGG - Intergenic
914938366 1:152000574-152000596 ATCTGCATGCAATTAAAAGTGGG - Intergenic
914982362 1:152425945-152425967 ATTAGCATGTCATTAAAAGTGGG + Intergenic
915259315 1:154664948-154664970 ATTTGCATGTAATTAAAAGTGGG + Intergenic
916005800 1:160658939-160658961 ATTTGCATATAATTAGAAGTGGG - Intergenic
916410519 1:164542654-164542676 ATTTGCATGTAATAACAAACAGG + Intergenic
916648147 1:166809237-166809259 ATTTGCATATAATTGAAAGTAGG + Intergenic
917205494 1:172566656-172566678 ATTTGCATATAATTAAAAGTGGG - Intronic
917613933 1:176717447-176717469 ATTAGCATATAATTAAAAGTGGG + Intronic
918420656 1:184361321-184361343 ATTTGCATGTAATTAAAAGTGGG - Intergenic
918682438 1:187372086-187372108 ATTTGCATGTAATTGAAAGTGGG + Intergenic
918682497 1:187372730-187372752 ATTTGCATGTAGTTGAAAATGGG - Intergenic
918794307 1:188873262-188873284 ACTTGCATGTCATTAAAAGTGGG + Intergenic
918804359 1:189020111-189020133 ATTTACATATAATCAAGAGTAGG + Intergenic
918928413 1:190818799-190818821 ATATGAATGAAATAAAAAGTTGG + Intergenic
919084843 1:192909725-192909747 CTAAGCATGTAATTAAAAGTAGG + Intergenic
919139711 1:193555773-193555795 CTTTGCATATTATTAAAAGTGGG + Intergenic
919180590 1:194076302-194076324 ATCTGCATGTAATTAAAAGCAGG + Intergenic
919383585 1:196890505-196890527 ATTTACATTTAATTTAAAATAGG + Intronic
920063419 1:203245846-203245868 ATTTGCATATAATTATAAGTGGG - Intronic
920411413 1:205764101-205764123 ACATGCATGTAATTAAATTTGGG - Intergenic
920606758 1:207396431-207396453 ATTTGCATATAATTAAAAATAGG - Intergenic
921045581 1:211475330-211475352 ATTTTCATCAAATGAAAAGTCGG + Intergenic
921073862 1:211684361-211684383 ATCTGCATGCAGTTAAAAGTGGG - Intergenic
921387250 1:214582567-214582589 GTTTGCATGTAAATTAAAGTGGG - Intergenic
921717611 1:218434441-218434463 ATTTGCAGGTAACCAAAACTTGG + Exonic
921753835 1:218829255-218829277 ATTTGCATATAAATAAAAGTAGG - Intergenic
921802402 1:219416588-219416610 ATTTGCATACAATTAAAAGTGGG - Intergenic
922221448 1:223611441-223611463 ATTTGCATATAATTAAAAGTTGG + Intronic
922459958 1:225808431-225808453 ATCTGCATGTAACTAAAAGTGGG - Intergenic
922538498 1:226401408-226401430 ATTTGCATATAATTAAAAGTGGG - Intronic
922812665 1:228426378-228426400 CTTTGCAGGTCATAAAAAGTGGG - Intergenic
923202465 1:231725519-231725541 ATTTGCCTGTAATTGAAAGTGGG + Intronic
923203072 1:231731347-231731369 ATTTGCATGTAATTAAAAGTAGG - Intronic
924001312 1:239555659-239555681 ATCTGCATGCAATTAAAAGTAGG + Intronic
924082682 1:240415712-240415734 ATAAGCATTTAATTAGAAGTAGG + Intronic
924131182 1:240910260-240910282 GTTTGTATGTAAATAAATGTGGG + Intronic
924848180 1:247794267-247794289 ATTTGCATGTAATTGGAAGTGGG + Intergenic
1063279926 10:4616759-4616781 ATTTTCATGCAATTTAAAGGCGG - Intergenic
1063746638 10:8891144-8891166 ATTTGCATATGATTAAAAGTAGG - Intergenic
1063818384 10:9805112-9805134 TTTTCCAAGTAATTAAAAGTAGG - Intergenic
1063887635 10:10595684-10595706 ATCTGTTTGCAATTAAAAGTAGG + Intergenic
1063925775 10:10975919-10975941 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1063965929 10:11345799-11345821 ATTTGCATGTGATTGAAAGTGGG - Intergenic
1063966821 10:11352486-11352508 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1064647357 10:17473108-17473130 ATTTGCATGTAACTGAAAGTGGG + Intergenic
1064689136 10:17895914-17895936 ATTTGCATGTAATTAAAAGTGGG - Intronic
1064800466 10:19064927-19064949 ATTTGCACGTAAATAACAATGGG - Intronic
1065105077 10:22375225-22375247 ATTCAAATGTAAATAAAAGTGGG - Intronic
1065253654 10:23842642-23842664 ACCACCATGTAATTAAAAGTTGG - Intronic
1065618253 10:27551097-27551119 ATTTGCATATGATTTAAAGTTGG + Intergenic
1066264968 10:33767647-33767669 GATTGTATGAAATTAAAAGTTGG + Intergenic
1066581186 10:36884248-36884270 ATATGAATGTAATTCAAAGTAGG + Intergenic
1067261951 10:44700498-44700520 ATTTGTATGAAATTAAAGGCAGG + Intergenic
1067366958 10:45640965-45640987 ATTTCAATGTAATTAATATTTGG + Intronic
1068284489 10:54916267-54916289 ATTTTCAGGTAAATAAAATTAGG - Intronic
1068378613 10:56216961-56216983 ATTTGCATATAATTAAAAGTGGG + Intergenic
1068402390 10:56547288-56547310 ATTTGCAGTCAATTAACAGTCGG + Intergenic
1068546492 10:58352432-58352454 ATTTGCCAGTTATTACAAGTAGG - Intronic
1068657266 10:59588558-59588580 ATTTGTGTGTAATTGAAAGTGGG - Intergenic
1068691504 10:59920445-59920467 ATTTGCATATAATTAAAAGTGGG - Intergenic
1069048180 10:63764873-63764895 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1069265784 10:66455628-66455650 ACATGCATGTAATTAAAAGTGGG + Intronic
1069670942 10:70203284-70203306 ATTTTCAGGTAATTCATAGTAGG - Intronic
1070184885 10:74052004-74052026 ATTAGAATATAATTAAAAGTGGG - Intronic
1070196301 10:74160332-74160354 ATTTGTATATAATTAAAATTGGG + Intronic
1070205322 10:74253279-74253301 ATCTGCATGTTATTAAAAAAGGG - Intronic
1070501886 10:77080243-77080265 ATCTGCATGCAATTAAAAGTAGG + Intronic
1071166970 10:82818097-82818119 ATCTGCATACAATTAATAGTGGG - Intronic
1071436116 10:85649460-85649482 ATTTGCCTGTAATGAAAGGAGGG + Intronic
1071478669 10:86046223-86046245 ACCTACAAGTAATTAAAAGTAGG + Intronic
1071946552 10:90652293-90652315 ATTTGCATATAATTAAAAGTGGG + Intergenic
1072264288 10:93712697-93712719 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1072397225 10:95057032-95057054 ATATGCATGCAATTAAAAGTGGG - Intronic
1072417072 10:95257784-95257806 TTTTGTATATAATCAAAAGTGGG - Intronic
1072887882 10:99296464-99296486 ATCTACATGCAATTAAAAGTGGG + Intergenic
1072888954 10:99304332-99304354 ATCTGCATGCAATTAAAAGTGGG + Intergenic
1072960632 10:99926081-99926103 TTTTGCATGTAAATAATATTAGG - Intronic
1073078650 10:100841953-100841975 TCTTGCAAGTAATTAAAAGGAGG + Intergenic
1073127230 10:101158918-101158940 ATTTGCATATAGTTAAAAGCGGG + Intergenic
1073195758 10:101689936-101689958 ATTTGCCTGGAATTAACAATAGG - Intronic
1073624516 10:105083124-105083146 ATAGTCATTTAATTAAAAGTAGG + Intronic
1073793325 10:106961797-106961819 ATTTGCAAGTTATTAAAAGTGGG + Intronic
1073893391 10:108125272-108125294 ATTCACATATAATTAAAAGTGGG - Intergenic
1073936115 10:108634379-108634401 ATTAGCATGTTATTAAAAGTGGG - Intergenic
1073986901 10:109219954-109219976 ATTTTCATGTCTTGAAAAGTGGG + Intergenic
1074390760 10:113056364-113056386 ATTTGAATCTAATTGGAAGTGGG + Intronic
1074735819 10:116431534-116431556 ATATGCATGTGATTAAATATGGG - Intronic
1074992552 10:118722964-118722986 ATTTGCATATAATTAAAAGTAGG + Intronic
1075363633 10:121862925-121862947 ATTTGCATGCAATTAAAGGGGGG + Intronic
1075528607 10:123207466-123207488 ATCTGCATGTTATGAAAATTTGG + Intergenic
1076200552 10:128554414-128554436 ACTTGCATGTAACTGAAAGTAGG - Intergenic
1076486477 10:130822495-130822517 ATTCACATGTATTTAAAAGTGGG - Intergenic
1077039521 11:513006-513028 ATCTACATGAAATTAAAAGTGGG + Intergenic
1077151285 11:1074229-1074251 AGTTACATGTAATTAGAACTTGG - Intergenic
1077210307 11:1368058-1368080 AAGTGCATGCAATTACAAGTGGG - Intergenic
1077558836 11:3243011-3243033 ACTCACATGTAATTAAAAGTGGG + Intergenic
1077583890 11:3435676-3435698 ATCTACATGCGATTAAAAGTGGG - Intergenic
1077983105 11:7321735-7321757 ATTTGTATGTAATTGGAAGTGGG - Intronic
1077986231 11:7354075-7354097 ATTTGATTGGAATTAAAAGAGGG + Intronic
1078409878 11:11105658-11105680 ATCTGTATGCAATTAAAAGTGGG + Intergenic
1078499504 11:11856339-11856361 ATTTGCATACAAATCAAAGTGGG + Intronic
1078856836 11:15212598-15212620 ATTTGCATGAAATCATAACTAGG - Intronic
1079064022 11:17274247-17274269 ATTTGCATATACTTAAAAGTGGG + Intronic
1079912513 11:26329037-26329059 TTTTGCATGTCATTAAAATTTGG + Intronic
1080147037 11:28998519-28998541 ATAGGCATGTAAATAAAAGATGG - Intergenic
1080463426 11:32475433-32475455 ATCTACATGTAATTAGAAGTAGG - Intergenic
1080650289 11:34217039-34217061 ATTTGCATATAATTAAAAGTGGG + Intronic
1081050772 11:38337983-38338005 ATTGACTTTTAATTAAAAGTAGG - Intergenic
1081178418 11:39957812-39957834 ATTTGCATGTATTACAAAGTAGG - Intergenic
1081338778 11:41902190-41902212 ATTTGCATGTAATTAGAAATAGG + Intergenic
1081842715 11:46214902-46214924 ATTTGTATATAATTAAAAGTGGG + Intergenic
1082827871 11:57594013-57594035 ATCTGCATGTAATGGAAAGTGGG + Intergenic
1082898516 11:58219557-58219579 ATTAGCATTAAATTGAAAGTGGG + Intergenic
1083543487 11:63531438-63531460 ATTAGCATATAATTAAAAGTGGG - Intergenic
1083699082 11:64462688-64462710 ATCTGCATGCAATTAAAAGTAGG - Intergenic
1083700339 11:64473252-64473274 ATTTGCATGCAATTGAAATTGGG + Intergenic
1083817805 11:65146801-65146823 ATTTGCATATAATTAAAAGTGGG - Intergenic
1083982420 11:66183804-66183826 ATTTGCATGTAATTAAGAGTGGG - Intronic
1084186153 11:67472954-67472976 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1084240795 11:67818349-67818371 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1084368652 11:68721485-68721507 ATCATCATGTAATTAAAGGTCGG - Intronic
1084406230 11:68975233-68975255 ACTTGCATATAATTGAAAGTGGG + Intergenic
1084546041 11:69815624-69815646 AATTGCATGTAATGACTAGTTGG + Intronic
1084697768 11:70766104-70766126 ATGTGCATGTCCTTAAAAGAGGG + Intronic
1084731832 11:71078791-71078813 ATTTGCATGTAATTAAAAGTGGG + Intronic
1084831644 11:71774363-71774385 ATCTGCATGTAATTAAAAGTGGG + Intergenic
1086069798 11:82788060-82788082 ATTTGCATGAAAATAGAAGCGGG - Intergenic
1086427630 11:86702439-86702461 ATTTGCATGTAGTTAAAAGTGGG - Intergenic
1086553954 11:88087627-88087649 ATGTGCATGCAATTTAAATTGGG - Intergenic
1086554420 11:88091899-88091921 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1086861347 11:91928020-91928042 ATTAGCAAGTATTTAAAACTTGG - Intergenic
1086886965 11:92217351-92217373 CTTTGCATAGATTTAAAAGTTGG + Intergenic
1087005393 11:93466014-93466036 ATCTGCTTGTATTTAAAAGTGGG + Intergenic
1087184314 11:95171038-95171060 ATTTGTATGTATTGAAAAGGAGG - Exonic
1087664563 11:101028872-101028894 TTTAGCATATAATTAAGAGTTGG + Intergenic
1087740976 11:101886500-101886522 ATTTACATGACAATAAAAGTAGG + Intergenic
1088181468 11:107117429-107117451 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1088380189 11:109184341-109184363 ATTTACATGTAATTGAAAGTGGG - Intergenic
1088566153 11:111175225-111175247 ATCTACATGTAATTAAAAGTCGG - Intergenic
1088792044 11:113234877-113234899 ATATGCATAGAATTGAAAGTCGG - Intronic
1088833417 11:113557294-113557316 ATCTACATGTCATTAAAAATGGG - Intergenic
1088891375 11:114047384-114047406 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1089161633 11:116442418-116442440 ATTAACATATAATTAAGAGTGGG - Intergenic
1089225880 11:116921250-116921272 ATTTGCATGCCAATAAAATTAGG + Intronic
1089824755 11:121265090-121265112 ATCTGAATGTTATTAAAAGCTGG + Intergenic
1090153340 11:124408872-124408894 ATTTGCATGCAATTAGAAGTAGG + Intergenic
1090712425 11:129399722-129399744 ATTTACATATAATTAAAAGGGGG - Intronic
1090713837 11:129412573-129412595 ATTTGCATATAATTAAAAGTGGG - Intronic
1091467094 12:694250-694272 ATTTGCATATAATTAAAAGTGGG + Intergenic
1092135121 12:6141983-6142005 ACTTGCAAGTAATTGAAAGTGGG - Intergenic
1093052073 12:14515736-14515758 AAGTGCATGTACTTGAAAGTAGG - Intronic
1093053489 12:14531938-14531960 AAGTGCATGTATTTGAAAGTAGG + Intronic
1093126194 12:15331102-15331124 ATTTGCCTGAAATTAACAATCGG - Intronic
1093227546 12:16503827-16503849 ATTTGCATTTAATTAAAAGTGGG + Intronic
1093269196 12:17037916-17037938 ATTTTGAGGAAATTAAAAGTTGG - Intergenic
1093627821 12:21371077-21371099 ATCTGCATGTAGTTAAAAGTGGG - Intronic
1094475954 12:30840717-30840739 ACTTGCATATTATTAAAAGTGGG - Intergenic
1094581440 12:31737421-31737443 ATTTGCATGTAATTAGAAGTGGG - Intergenic
1095162221 12:38932157-38932179 AGTTGCATCTAAATAAACGTGGG + Intergenic
1095257929 12:40062127-40062149 TTTTGTATGTAATAAGAAGTAGG - Intronic
1095708369 12:45262199-45262221 ATTTGCATTTTTTTAAAAGGCGG - Intronic
1096278460 12:50230907-50230929 ATTTTCCTGTAATTAAAAAATGG - Intronic
1096664141 12:53151118-53151140 ATCTACTTGTAATTAAAAGGAGG - Intergenic
1096929828 12:55195390-55195412 ATTTGCAAGAAATTACAAATAGG + Intergenic
1096971095 12:55666984-55667006 ATCTGCATGCAGTTAAAAGTAGG + Intergenic
1097497396 12:60357976-60357998 TTTTTCATGAAATTATAAGTGGG - Intergenic
1097878471 12:64665690-64665712 ATTTGCATGTAATTAAAAATGGG + Intronic
1098336436 12:69409797-69409819 ATCTATATGTAATTAAAATTAGG + Intergenic
1098770474 12:74546583-74546605 AATTGAATGTAATTAGAAGATGG + Intergenic
1098898910 12:76092650-76092672 ATTTACATATAATTAAAAGTGGG + Intergenic
1099007770 12:77255109-77255131 ATTTGGATGTTTTTAAAAGGAGG + Intergenic
1099023288 12:77433311-77433333 AGTTTCATGTAATAAAAAGCTGG + Intergenic
1099529690 12:83762738-83762760 ATCTGCATGCAATTAAAAGTGGG + Intergenic
1099562492 12:84195393-84195415 ATTTGCATGTAACTGAAAGTGGG + Intergenic
1099705107 12:86142383-86142405 ATTTTCATGTAATTAAAGTGAGG + Intronic
1099767698 12:87009778-87009800 ATTTGCATGGGATTAGAAGTTGG + Intergenic
1099839129 12:87943945-87943967 ATTTGCATGTAACTGAAAGTAGG - Intergenic
1099869757 12:88332079-88332101 GTTTGCATATAATTAAAAGTGGG - Intergenic
1100479366 12:94963041-94963063 ATTTTCCTGTAAATAAAAGAAGG + Intronic
1100548960 12:95628793-95628815 ATTTGCATATAATTAAAAGTGGG + Intergenic
1100649031 12:96564547-96564569 TTTTACAGGTAATTAAAATTGGG + Exonic
1100791790 12:98138309-98138331 ATTTGCAACTATTTTAAAGTAGG - Intergenic
1101043459 12:100780430-100780452 ATTAGCATATGATTAAAAGTAGG - Intronic
1101285171 12:103304315-103304337 ATATGCAGGCAATAAAAAGTAGG + Intronic
1101354300 12:103962700-103962722 ATTTGCATATAATTAGAAGTGGG + Intronic
1101397538 12:104361666-104361688 ATTTGCATGTAATAAAAAGTGGG + Intergenic
1101530463 12:105568772-105568794 ACTTGCATATAATTAAAAGTGGG - Intergenic
1102433961 12:112905784-112905806 ATTTGCACGTATTTAAAAGTGGG - Intergenic
1102448992 12:113026527-113026549 ATTTGCATATAATTAAAAATGGG - Intergenic
1102449749 12:113032532-113032554 ATTTTCATATAATTAGAAGTGGG + Intergenic
1102666376 12:114577542-114577564 ATCTGCATGTAATTAAACGTAGG - Intergenic
1102734024 12:115141354-115141376 ATGTGCAAGAAATTAAAATTAGG + Intergenic
1102816168 12:115868191-115868213 AATTGCATATAATTAAAAACGGG + Intergenic
1102883770 12:116506545-116506567 ATCTGCATGCAATTTAAAGTAGG + Intergenic
1102910522 12:116710200-116710222 ATTTGTATGTAAATAAAGGTAGG - Exonic
1102921913 12:116797806-116797828 ATCTACATGTAATTAAAAGTAGG - Intronic
1102935366 12:116892026-116892048 GTCCACATGTAATTAAAAGTAGG - Intergenic
1103233900 12:119355752-119355774 ATTTGCATATAATTAAAAATGGG - Intronic
1103247092 12:119467053-119467075 TTCTACATGTAATTAAAAGTGGG + Intronic
1103408167 12:120690607-120690629 TTTTACATGGAATTAAAAATAGG + Intronic
1103458410 12:121085379-121085401 ATTGGCATATAATTAAGAGTAGG + Intergenic
1103460690 12:121102398-121102420 ATTTGCATATAATTAAAAGTAGG - Intergenic
1103879000 12:124151666-124151688 ATTTGCATGTTATTGAAAGTGGG - Intronic
1104195612 12:126534509-126534531 ATTTGCATATAATTGAAAGTAGG - Intergenic
1104434293 12:128743435-128743457 ATTTGCACATAATTAAAAGTAGG + Intergenic
1104561144 12:129845908-129845930 ATTTGCATGTAATTAAAAGTGGG - Intronic
1104621124 12:130313559-130313581 ATTTTCATGTAATTAAAAGTGGG + Intergenic
1104646533 12:130501638-130501660 ATTTGCATGTAATTAAAACCTGG + Intronic
1104756043 12:131269864-131269886 ATTTGCATGTAATTAAGAGGGGG - Intergenic
1105293504 13:19069906-19069928 CTTTGCATGTGACTGAAAGTTGG - Intergenic
1105421786 13:20258953-20258975 ATTTGCATGAAATAAAAAGAAGG - Intergenic
1105672026 13:22629687-22629709 ATTAACATATAATTAAAAGTGGG + Intergenic
1105706835 13:22972411-22972433 ATCTGAATGCAATTAAAAATGGG + Intergenic
1105796253 13:23856482-23856504 ATTTGCATTTAAATAACAGTGGG - Intronic
1105938949 13:25129866-25129888 AATTACATGGAATAAAAAGTTGG + Intergenic
1106507136 13:30380919-30380941 ATTTGCTTGTAATTGAAAGTTGG - Intergenic
1106746022 13:32708095-32708117 GTCTGTATATAATTAAAAGTAGG + Intronic
1106820875 13:33463318-33463340 ATTTGTGTATAATTACAAGTGGG - Intergenic
1106859590 13:33890912-33890934 ATTTGCATGTTTTAAAAATTAGG - Intronic
1107978273 13:45710906-45710928 ATTTGCATGGTATATAAAGTTGG - Intronic
1108096953 13:46912505-46912527 ATCTGCATGTAATTAGAAATGGG - Intergenic
1108232850 13:48368616-48368638 ATTATAATATAATTAAAAGTAGG - Intronic
1108361320 13:49670546-49670568 ATTTGTATGACATTAAAACTGGG + Intronic
1108377720 13:49828862-49828884 ATTTGCATATACTTAAAAGTGGG + Intergenic
1108773913 13:53739910-53739932 ATCTGCATGAAATTAAAAGTGGG + Intergenic
1108793110 13:53996758-53996780 ATTTACACGTAATTACAAATTGG + Intergenic
1109141735 13:58720746-58720768 ATTTGCATGAAGTTAAATATAGG - Intergenic
1109192975 13:59347109-59347131 ATTTACATGTAATTACAAGTAGG - Intergenic
1109379128 13:61535469-61535491 ATTAGCACATAATTAAAAGTGGG + Intergenic
1109412836 13:61995918-61995940 ATTTTCATGGAGTAAAAAGTTGG - Intergenic
1109419014 13:62085421-62085443 ATCTGCATGTTATTAAAAGTGGG + Intergenic
1109505242 13:63292156-63292178 ATTTACATGTATTTCAAAGAGGG + Intergenic
1109599666 13:64608326-64608348 ATTGGCATTTAATTAATATTTGG - Intergenic
1110293754 13:73838686-73838708 ATTTGCATGAAAGAAAATGTGGG + Intronic
1111131687 13:83985039-83985061 ACTTGCTTATAGTTAAAAGTGGG - Intergenic
1111140532 13:84112567-84112589 ATTTGCTTTTATTTAAAAATGGG - Intergenic
1111208319 13:85041589-85041611 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1111450505 13:88408894-88408916 ATTTGCATGTAATTAAAAGTAGG - Intergenic
1111514314 13:89307925-89307947 ATTGACATTTAATTAAAAGGTGG - Intergenic
1111532920 13:89563330-89563352 ATTTTCCTGTTATTAACAGTGGG + Intergenic
1111650925 13:91090132-91090154 AGTGGCTTTTAATTAAAAGTAGG + Intergenic
1111703075 13:91715022-91715044 ATCTGCATGTAATTAGAAGTAGG - Intronic
1112022128 13:95380691-95380713 ATTTGCATATAGTCGAAAGTGGG - Intergenic
1112139706 13:96625118-96625140 ATTCACACGTAATTAAAAGTGGG - Intronic
1112150431 13:96754550-96754572 ATTTTCAGGTAAACAAAAGTGGG - Intronic
1112404946 13:99111137-99111159 AATTGCAGATAATTAAGAGTTGG - Intergenic
1112582480 13:100688408-100688430 ATTTGCATGTGCTTGAAAGTGGG - Intergenic
1112583568 13:100697140-100697162 CTTTGCATGTAATTGAAAGTGGG - Intergenic
1112591105 13:100763651-100763673 ATTTGCACGTAATTATAAGTGGG + Intergenic
1112751478 13:102588302-102588324 ATTTGCATGCAATTGTAAGTGGG - Intergenic
1112816361 13:103278369-103278391 ATTTGCATATAATTAAAAGTTGG + Intergenic
1113209214 13:107955529-107955551 ATCTATATGTAATTAAATGTAGG + Intergenic
1113592150 13:111508514-111508536 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1114223373 14:20716761-20716783 AATTGCATCTAAATAAATGTGGG + Intergenic
1114850631 14:26378812-26378834 ATTTGCATGTAATTGAAAGTAGG - Intergenic
1114865494 14:26589421-26589443 ATTTACTTGTAATTAAATGTGGG + Intronic
1114877813 14:26743931-26743953 AGTTAAATGTTATTAAAAGTTGG + Intergenic
1114894267 14:26966833-26966855 AATTGAATGTAAATAAAAGGAGG - Intergenic
1115055329 14:29119061-29119083 ATTAGCATCTAATTAATATTTGG - Intergenic
1115139330 14:30151128-30151150 ATTTGCATGTAATTGAAATTTGG + Intronic
1115358885 14:32479437-32479459 ATTTACATGTAATAAAAAATTGG + Intronic
1115875858 14:37860901-37860923 TTTGGCATGCAATTAAATGTAGG + Intronic
1116145935 14:41069207-41069229 ATTTGCATGCAATTAAAAGGGGG - Intergenic
1116259346 14:42602955-42602977 ATATGCATGTAATTAATAGTAGG - Intergenic
1116582258 14:46656994-46657016 ATTTTCATGTAGTAAAAAGAGGG - Intergenic
1116628472 14:47297791-47297813 AAATGCATGTAATTTAAAGCAGG + Intronic
1116734685 14:48673798-48673820 ATTTGCAATTAATAAAAATTGGG + Intergenic
1117279295 14:54221918-54221940 CTTTGTAGGTAATTTAAAGTTGG + Intergenic
1117665109 14:58048421-58048443 ATTTGGATGTAATTAATAGCAGG + Intronic
1117784833 14:59272168-59272190 GTTTCCATGAGATTAAAAGTTGG + Intronic
1117880642 14:60310094-60310116 ATTTGCATATAATTAAAAGTGGG - Intergenic
1118798976 14:69171882-69171904 ATCTGCATGCAATTAAAAGTAGG + Intergenic
1119032699 14:71204976-71204998 ATTTGCATATTATTAAAAGTGGG - Intergenic
1119381244 14:74230174-74230196 ATTTGCATGCAATTTAAAGTGGG - Intergenic
1119440484 14:74624951-74624973 ATTTGAATATCATTAAAAATAGG - Intergenic
1119997171 14:79265924-79265946 ATTTGCTTGAAATTAACAGGTGG + Intronic
1120036727 14:79706351-79706373 ATTTGCATATATTTGAAAGTGGG - Intronic
1120060362 14:79975584-79975606 ATTTGCATATAATTAAAAGTGGG - Intergenic
1120197331 14:81499272-81499294 ATCTACATGTAAATGAAAGTTGG - Intronic
1120323983 14:83002437-83002459 ATTTGCATGTTATGAGAAGAGGG + Intergenic
1120327443 14:83049254-83049276 ATTTGCATGTAAATAAAAGTGGG + Intergenic
1120550022 14:85858901-85858923 ATTAGCCTATAATTAAGAGTGGG + Intergenic
1120630967 14:86889610-86889632 AATTGTCTGGAATTAAAAGTAGG - Intergenic
1120784423 14:88518910-88518932 ATGTGCATGTAATGAAATTTTGG - Intronic
1120813738 14:88831330-88831352 ATTTGCATGTAATTGAAAGTGGG + Intronic
1121836885 14:97100379-97100401 ATCTACATGTAATTAAAAGTAGG - Intergenic
1122002697 14:98674843-98674865 ATTTGCATATAACTAAAAGTGGG - Intergenic
1122436457 14:101704409-101704431 ATTTGCATATAATTAAGCATGGG + Intergenic
1122796330 14:104207941-104207963 ATCTGCATGCCATTAAAAATGGG + Intergenic
1122850745 14:104528920-104528942 ATCTGCATGCAATTAAAAGTGGG + Intronic
1122962347 14:105100989-105101011 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1123829614 15:24121057-24121079 ATTTACATGTAATTGAAAGTGGG - Intergenic
1123835199 15:24182950-24182972 ATTTGCATATAATTAAAAGTGGG - Intergenic
1123849956 15:24344306-24344328 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1123854895 15:24398861-24398883 ATTTGTGTATAATTAAAAGTGGG - Intergenic
1123859611 15:24450721-24450743 ATTTACATGTAATTGAAAGTGGG - Intergenic
1123870926 15:24571845-24571867 ATTTGCATATAATTAAAAGTGGG - Intergenic
1124016707 15:25883094-25883116 ATTTGCCTGTGATTAAAAGTGGG + Intergenic
1124713587 15:32035391-32035413 ATTTGTATATAATTACATGTTGG - Intronic
1124934306 15:34155913-34155935 AATTGCATCTAAATAAATGTGGG + Intronic
1125558204 15:40603836-40603858 ATTTGCATATAATTAAAAATGGG - Intronic
1125757985 15:42078049-42078071 ATTTGCATGTAATTAAAAATGGG + Intronic
1126492561 15:49254874-49254896 ATTTTCTCATAATTAAAAGTTGG - Intronic
1127277463 15:57459984-57460006 ATTTACATAGAATTAATAGTTGG + Intronic
1128731267 15:70023126-70023148 ATCTACATGCAATTAAAAGTAGG - Intergenic
1129147967 15:73666459-73666481 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1129327728 15:74810206-74810228 ATTTTCATCCAAATAAAAGTTGG - Intergenic
1129950499 15:79584905-79584927 GTTAGCATGTAATTCAAAGAGGG + Intergenic
1129964697 15:79723852-79723874 ATTTTCATATGATTAAAAATGGG - Intergenic
1130037350 15:80373142-80373164 ATTTGCATGTTATTAAATATGGG - Intronic
1130079723 15:80722000-80722022 ATTAGCATGCAACTAAAAATAGG - Intronic
1130324531 15:82869032-82869054 ATTTGCATGTAATTAAAAGTAGG + Intronic
1131192015 15:90324480-90324502 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1131647968 15:94366555-94366577 ATTTGCAGTTAATTACAAATAGG - Intronic
1131790925 15:95964859-95964881 ATTTGCATATAATTAAAATTAGG + Intergenic
1132456541 16:26862-26884 ATTTGTATATAGTTACAAGTGGG - Intergenic
1132479008 16:156845-156867 ATTTGCATATAATGAAAAGTGGG - Intronic
1132875956 16:2137321-2137343 ATTTGACTGCAATTAAAAGCTGG - Intergenic
1133165435 16:3943688-3943710 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1133352262 16:5109243-5109265 ATCTGCATGCAGTTAAAAGTGGG - Intergenic
1133447874 16:5877737-5877759 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1133498756 16:6345354-6345376 ATTTCCATGTAATTAAAAGTGGG - Intronic
1133549306 16:6838488-6838510 ATTTGCATGCAATTAAAAGTGGG + Intronic
1133716743 16:8457484-8457506 ATTTGCATATAATTAGAAGTAGG + Intergenic
1133724365 16:8523628-8523650 ATTTGCATGTAATTAAAATTGGG - Intergenic
1133728028 16:8555401-8555423 ATTAGTATATCATTAAAAGTGGG - Intergenic
1134401449 16:13913979-13914001 ATTTTCATATAATGAAAAGTGGG - Intergenic
1134749970 16:16618165-16618187 ATTTGCATATCATTAAAAGTGGG - Intergenic
1134995506 16:18735450-18735472 ATTTGCATATCATTAAAAGTGGG + Intergenic
1135056643 16:19237582-19237604 ATCTACATGTAATTAAACGTAGG + Intronic
1135355902 16:21768789-21768811 ATCTGCATATAATTAAAAGCAGG - Intergenic
1135416590 16:22273235-22273257 ATATGCATGCAATTAAAAGTAGG - Intronic
1135454392 16:22584928-22584950 ATCTGCATATAATTAAAAGCAGG - Intergenic
1135491377 16:22912691-22912713 ATTTGCATGTAATTAGAAGTGGG - Intronic
1135534510 16:23282800-23282822 ATTTGTATGTAATTAAAAGTAGG + Intronic
1135536488 16:23298425-23298447 ATTAGCATGTCATTAAAAGTGGG - Intronic
1135783432 16:25326500-25326522 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1135793372 16:25419211-25419233 ATCTTCATGCAATTAAAAGTGGG - Intergenic
1135794217 16:25425904-25425926 ATTTGCATGTAATTAAAAATGGG + Intergenic
1135904584 16:26499475-26499497 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1135949310 16:26898386-26898408 ATTTGCATGTAATTAAAAATGGG + Intergenic
1135980606 16:27143977-27143999 ATTTGCATTTAATTAAAAGTGGG - Intergenic
1136614245 16:31386886-31386908 ATTTGCATGTAATTAAAAGTCGG + Intergenic
1136646921 16:31628773-31628795 GTTTGCATGTAATGAAAAGTGGG + Intergenic
1136658261 16:31727501-31727523 GTTTGCATGTAATGAAAAGTGGG - Intronic
1136689378 16:32017940-32017962 ATTTGCATACAATTAAAAGTGGG + Intergenic
1136789970 16:32961482-32961504 ATTTGCATACAATTAAAAGTGGG + Intergenic
1136879842 16:33892454-33892476 ATTTGCATACAATTAAAAGTGGG - Intergenic
1137405769 16:48188092-48188114 ATCTACATGTAATTAAAAGTAGG + Intronic
1137846822 16:51698022-51698044 ATTTTCATGTAATTAACAGCAGG - Intergenic
1138777429 16:59740887-59740909 ATTTGCATAAAATTGAAAGTGGG - Intronic
1138814328 16:60186831-60186853 ATTTGAGTATAATTAAACGTGGG + Intergenic
1138850812 16:60627441-60627463 ATTTGCGTACAATTAAAAGCGGG - Intergenic
1138859292 16:60735935-60735957 ATTTGCATGCAATTAAAAGTGGG + Intergenic
1138862994 16:60781763-60781785 ATATGCATGAAATTAATAGATGG + Intergenic
1138965560 16:62080051-62080073 AATTGCATGCATTAAAAAGTGGG - Intergenic
1138977537 16:62226036-62226058 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1139037544 16:62965897-62965919 CTTAGCATATAATTAAAAGTGGG - Intergenic
1139102461 16:63785246-63785268 ATTTGCATGTCATTTAAGCTGGG - Intergenic
1139102896 16:63789585-63789607 GTTTACATGTACTTGAAAGTGGG - Intergenic
1139112611 16:63909472-63909494 ATTTTTAGGTAATTAACAGTTGG + Intergenic
1139681753 16:68570454-68570476 ATTTGCATGTAATTAAAAATGGG - Intronic
1139827978 16:69772604-69772626 ACTTGCATATAATTAAAACTGGG - Intronic
1139947158 16:70649294-70649316 ATCTGCATGCAATTAAAGGTGGG - Intronic
1140020851 16:71237329-71237351 ATTTGCATATAATTTACAGTGGG - Intergenic
1140300590 16:73753503-73753525 ATTTTCATGTAATTAAAAGTGGG + Intergenic
1140339808 16:74146501-74146523 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1140543280 16:75780117-75780139 ATCTGCATGCAATTAAAAATGGG + Intergenic
1140579175 16:76208521-76208543 ATTTGCATGTAATTGGAACCTGG + Intergenic
1140757344 16:78079679-78079701 ATCTGCATGCAATTAAAAGTAGG + Intergenic
1140838753 16:78819505-78819527 ATTTGCATATAATTAAAAATGGG + Intronic
1141072215 16:80968137-80968159 ATTTGCATGCATATAAAAATTGG - Exonic
1141410948 16:83832742-83832764 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1141847325 16:86619663-86619685 ATCTGCATGCAATTAAAAGTAGG + Intergenic
1142109697 16:88324672-88324694 ATTCGCACATACTTAAAAGTGGG - Intergenic
1142158010 16:88541528-88541550 ATTTGCATGTAATTGAAGAGGGG - Intergenic
1142162616 16:88566456-88566478 ATCTGCATGTAATTAAAAGTGGG + Intergenic
1142294300 16:89210328-89210350 ATTTGCATATAATTAAAAGTGGG + Intergenic
1203092173 16_KI270728v1_random:1222945-1222967 ATTTGCATACAATTAAAAGTGGG + Intergenic
1142501123 17:333991-334013 AGTTGCATCTACTTAAAAGAAGG + Intronic
1142644617 17:1303792-1303814 CTTTGTATGCAATTTAAAGTTGG + Intergenic
1143277572 17:5723145-5723167 ATATGGATGGAAATAAAAGTAGG - Intergenic
1143368608 17:6424382-6424404 ATCTACATGTAATTAAAAGTGGG + Exonic
1143437823 17:6942272-6942294 ATTTGCATATAATTAGAAGTGGG + Intronic
1143441573 17:6978653-6978675 ATTAGCATGTCACTAAAAGTGGG + Intronic
1143522463 17:7452714-7452736 ATCTGCATGCAATTAAACGTAGG + Intronic
1144129992 17:12237641-12237663 TTTGGCAGGTAACTAAAAGTGGG + Intergenic
1144221281 17:13102047-13102069 ATCTGCATGCAATTAAAGGTAGG + Intergenic
1144281093 17:13727260-13727282 ATTTGCATGTAAATGAAAGTGGG - Intergenic
1144413563 17:15024159-15024181 ATGTACATGTAATTAAAAGTGGG - Intergenic
1144424863 17:15132312-15132334 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1146087979 17:29847903-29847925 ATTTACATGTAATTGAAAGTGGG + Intronic
1146658311 17:34648346-34648368 ATTTGCATATAATTAATAGTGGG - Intergenic
1146697198 17:34918705-34918727 TTTTTTATGTACTTAAAAGTTGG + Intergenic
1147152224 17:38524085-38524107 ATTTGCATACAATTAAAAGTGGG + Intergenic
1147431635 17:40375018-40375040 ATTTGCATATAACTAAAAGTGGG - Intergenic
1147445463 17:40472605-40472627 ATTTGCATGTGTTTAAAAGTGGG - Intergenic
1147486913 17:40824611-40824633 ATTTGCATGTGCTAACAAGTTGG - Intronic
1147504880 17:41006037-41006059 ATCTACATCTAATTAAAAGTAGG - Intergenic
1148136409 17:45294844-45294866 ATTTACATTTAATTAAAATGAGG + Intronic
1148389543 17:47261229-47261251 ATTTGCATTTATTTAAATGTAGG - Intronic
1148668668 17:49393768-49393790 TTTTGCATATAATTAAGAGTGGG + Intronic
1148674435 17:49437095-49437117 ATTCTCCTGTAAGTAAAAGTAGG - Intronic
1148931115 17:51128152-51128174 TTTTGCATGTGATTATAAGTGGG - Intergenic
1148968383 17:51457233-51457255 ATTTGCATGAAGTTCAAAGGGGG + Intergenic
1149132414 17:53319776-53319798 ATTTAAATGTATTTAAAAATTGG + Intergenic
1149270741 17:54974856-54974878 ATTTGCATATAATTAAAAGCGGG - Intronic
1149343246 17:55708501-55708523 ATTTGCATTTATTAAAAAATTGG + Intergenic
1149895779 17:60427233-60427255 ATTTGCAAGTAATTAAAAGCGGG - Intronic
1150013083 17:61524610-61524632 ATTTGCATATAATTAAAAAGTGG + Intergenic
1150146979 17:62777414-62777436 ATCTGCATGCTATTAAAAGTAGG + Intronic
1150161726 17:62903691-62903713 ATTTGTATGTGATTAAAAGTTGG + Intergenic
1150637887 17:66928986-66929008 ATTTGCATGTAATTAAAAGTAGG - Intergenic
1151076698 17:71281654-71281676 ATTTTCATAAAATTAAAAATTGG - Intergenic
1151077712 17:71293349-71293371 ATTTGCACATAATTAAAAGTGGG + Intergenic
1151255871 17:72876011-72876033 ATCTAAATGTAATTAAAAGTAGG + Intronic
1151463727 17:74271351-74271373 ATTTGCATGTAATTAAAAATGGG - Intergenic
1151775146 17:76196020-76196042 ATTTGCACATAATTAAAAGTGGG + Intronic
1152009605 17:77703893-77703915 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1152044484 17:77927038-77927060 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1152292264 17:79446681-79446703 ATTTGCATGCAATTAAAAGTGGG + Intronic
1152803579 17:82343784-82343806 ATTTGCATGTAGTTAAAAGTGGG + Intergenic
1153023598 18:654727-654749 ATTTGCATGTAATTGAAAGTAGG - Intronic
1153129735 18:1841193-1841215 ATTTGCATATAATTAAAAGTGGG + Intergenic
1153458839 18:5311493-5311515 ATTTGCATGCAGTCAAAAGGAGG + Intergenic
1153573544 18:6497630-6497652 ATTTTCACAAAATTAAAAGTAGG - Intergenic
1153707429 18:7760423-7760445 ACTTTCATTTACTTAAAAGTTGG - Intronic
1154086234 18:11308161-11308183 ATTGGCATATAGTTAAAATTGGG + Intergenic
1155372513 18:25116637-25116659 ATTAGCATGTGAATAAAAGCAGG + Intronic
1155523933 18:26697534-26697556 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1155572344 18:27209835-27209857 ATTTGTATGTAAATAAAGGAGGG + Intergenic
1155630133 18:27883417-27883439 ATTTGCATGCACTTAAAAGTAGG - Intergenic
1155680886 18:28483965-28483987 ATTTGTATACAATTAAAAGTGGG + Intergenic
1155764482 18:29610298-29610320 ATTAGCATATAATTAAGACTAGG + Intergenic
1155980627 18:32176195-32176217 ATTAGCTTGTAATTAAAATGTGG - Intronic
1156154023 18:34280480-34280502 ATTAGCATGAAATTAAAAATAGG + Intergenic
1156187494 18:34680103-34680125 TTTTGCTTAGAATTAAAAGTAGG + Intronic
1156316783 18:35976876-35976898 ATTTGTATTTAATTTAAAATAGG - Intronic
1156603365 18:38637260-38637282 ATTTTGATGTAAGTAAAACTTGG + Intergenic
1156644772 18:39147846-39147868 ATTTCCATATAGTTAAAAGTGGG - Intergenic
1156874993 18:41999658-41999680 ATTTACACATAATTAAAATTAGG + Intronic
1156988084 18:43372895-43372917 ATATACATGTAATTAAAATTAGG + Intergenic
1157046600 18:44107648-44107670 ATTAGTACGTCATTAAAAGTGGG - Intergenic
1157051208 18:44167424-44167446 ATTGGTATGTGATTATAAGTGGG - Intergenic
1157076306 18:44471412-44471434 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1157467320 18:47958450-47958472 ATTTCCATGCAATAAATAGTTGG - Intergenic
1157746579 18:50141326-50141348 ATTTACCTGTAATTAAAAATAGG + Intronic
1158733570 18:60054080-60054102 ATTTACATATGATTAAAAGCTGG - Intergenic
1159079860 18:63724815-63724837 AGTTGCATGCTATTATAAGTAGG - Intronic
1159095830 18:63900563-63900585 ATCTACATGTAATTAAAAGTAGG - Intronic
1159108469 18:64029285-64029307 ATTTGCATGTAATTATAAGAGGG - Intergenic
1159184446 18:64950419-64950441 ATTTGCATGTAAGTAATAGCGGG - Intergenic
1159246997 18:65819259-65819281 ATTTGCATGTAATTGAAATTGGG + Intronic
1159310496 18:66701639-66701661 ATTTGCATGTAATTAAAAGTAGG + Intergenic
1159311248 18:66712970-66712992 ATGTGTTTGTAATTAAAAATAGG - Intergenic
1159337077 18:67082056-67082078 ATTTGCATGCAATTGAATGTGGG + Intergenic
1159616528 18:70586460-70586482 TTTTGTATGTAATTGAAATTGGG + Intergenic
1159649141 18:70956602-70956624 ATTTGCAAATCATTAAAGGTGGG - Intergenic
1159653341 18:71003336-71003358 ACCTGCATGCAATTAAAAGTGGG + Intergenic
1159897822 18:74013325-74013347 ATTTGCATGTAATTGAAAGTAGG - Intergenic
1159902506 18:74060764-74060786 GTTTGCATGTAATTTAAAGTGGG + Intergenic
1159938898 18:74390425-74390447 GTCCACATGTAATTAAAAGTAGG - Intergenic
1160062871 18:75548673-75548695 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1160341627 18:78094284-78094306 ATTTGCATGCAGTTGAAAGCAGG - Intergenic
1160381280 18:78458075-78458097 ATGTACATGTAATTAAAGGGTGG - Intergenic
1160618158 18:80149603-80149625 ATTTGCTTTTAATTAATATTTGG + Intronic
1161248115 19:3266108-3266130 ATTTAAATGTAATTAAAAGTGGG - Intronic
1161525790 19:4754248-4754270 ATTTGCATATAATTAAAAGTGGG - Intergenic
1161862023 19:6805036-6805058 CTCTACATGTAATTAAAAGGAGG - Intronic
1161875202 19:6903122-6903144 ATCTGCATATTATTAAAAGTAGG - Intronic
1161970702 19:7578320-7578342 CTTTGCATGCAATTAAAAGTAGG - Intergenic
1162089566 19:8270137-8270159 ATCTGCATGCGATTAAAAGTGGG + Intronic
1162219524 19:9164318-9164340 ATTTGCATGTAATTAAAACTGGG - Intergenic
1162263781 19:9553207-9553229 ATCTACATGTAATTAAAAGTAGG + Intergenic
1162663018 19:12185119-12185141 ATTTGCATATAATTGAAAGTGGG - Intronic
1162668864 19:12237832-12237854 ATTTGCATTTAAGAAAAACTTGG + Intronic
1162880432 19:13654811-13654833 ATTTACACATAATTAAAAGTGGG - Intergenic
1163512443 19:17743597-17743619 ATTTGCATATAATTAAAAGTGGG - Intergenic
1163568318 19:18065035-18065057 ATTTGCATATAATTAAAAGCGGG + Intronic
1163769365 19:19181349-19181371 ATATGTATGTTTTTAAAAGTGGG + Intronic
1164193774 19:22935286-22935308 ATGTGCAGGTAGTTGAAAGTTGG + Intergenic
1164412126 19:28014781-28014803 ATCTACATGTGATTAAAAGTGGG + Intergenic
1164454575 19:28396599-28396621 ATTTGCATATAATTACAGGTGGG + Intergenic
1164561004 19:29292254-29292276 ATTTGCATGTCATTAAAAGTGGG - Intergenic
1164572506 19:29384734-29384756 ATCTGCATGTAATTAAAAGTGGG - Intergenic
1164779843 19:30883457-30883479 ATTTGCACGTAATTAAAAGTAGG + Intergenic
1164855825 19:31519965-31519987 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1164897514 19:31890211-31890233 CTCTGCATGTAATTAAAAGTGGG - Intergenic
1164974109 19:32558915-32558937 ATTTGCATGTAATTAAAAGTAGG + Intergenic
1165103147 19:33451014-33451036 CTCTGCATGTAATTAAAAGTGGG + Intronic
1165134743 19:33660739-33660761 GTTTGCATGCAATTGAAAGTGGG + Intronic
1165278611 19:34776842-34776864 ATCTGCATGTAATTAAAAGTGGG - Intergenic
1165377688 19:35454675-35454697 ATTTGTGTGCAATTAAAAGTAGG - Intergenic
1165881374 19:39046359-39046381 ATTTGCATGTAACTGAAAGTGGG + Intergenic
1166584832 19:43936499-43936521 ATTTGCATGTAATGAAAAGTTGG + Intergenic
1166652586 19:44585735-44585757 ATTTGCATGTAAGTGAAAGTTGG - Intergenic
1166955280 19:46460121-46460143 ATTTGCATATAATTAAAAGTGGG - Intergenic
1166957246 19:46472733-46472755 ATTAGCACGTCATTAAAAGTGGG - Intergenic
1167082933 19:47289711-47289733 ATTTGCATATAATTAAAAGTGGG - Intergenic
1167091378 19:47346347-47346369 ATCTACATGTAATTAAAAATAGG + Intergenic
1167598772 19:50441420-50441442 ATCTCTAGGTAATTAAAAGTGGG + Intronic
1167652489 19:50740372-50740394 ATTTGCATATAATTAAAAGTGGG + Intergenic
1167692427 19:50994650-50994672 ATTTGCATGTAATTGAAAATGGG + Intergenic
1167819173 19:51910346-51910368 CTTTGCATATAATTAAAAGTGGG + Intronic
1167975915 19:53225864-53225886 GTTTGCATGTAATTAAAAGTGGG + Intergenic
1168130764 19:54317085-54317107 ATTTGCATATAATTAAAAGCAGG + Intergenic
1168582790 19:57569373-57569395 CTTTGCATGTAGTTAAAAGCGGG + Intergenic
925027112 2:618751-618773 ATCTGCATGCAATTAAAAGTGGG + Intergenic
925475260 2:4206262-4206284 ATTTGCATATAATTAAAAATGGG - Intergenic
925532622 2:4881810-4881832 ATCTGCATGCAATTAAAAGTAGG - Intergenic
926144637 2:10389240-10389262 ATTTGCATGTAATTAAAAGTGGG + Intronic
926438338 2:12860481-12860503 ATTTGCATATACTTAAAAGTGGG - Intergenic
926552197 2:14314342-14314364 TTATGCATGAAAATAAAAGTAGG + Intergenic
926564454 2:14454413-14454435 ATTTGCATGTAATTAAAAATGGG + Intergenic
927382360 2:22493460-22493482 ATCTGCATGTTATTAAAAGTGGG + Intergenic
928346564 2:30503027-30503049 ATTTGCATGTAATTGAAAGTAGG - Intronic
928473817 2:31603212-31603234 ATTTACAAAAAATTAAAAGTGGG + Intergenic
928634669 2:33231800-33231822 ATTTGCATGCAATTAATTATGGG + Intronic
928686926 2:33759508-33759530 ATCCACATGCAATTAAAAGTGGG - Intergenic
929093817 2:38245319-38245341 AGTAGCATGTCATTAAAAGTGGG + Intergenic
930197436 2:48523549-48523571 ATATGCATGAAATAAAAAGCAGG - Intergenic
930497595 2:52167183-52167205 ATGTGTATGCTATTAAAAGTAGG - Intergenic
930865141 2:56115346-56115368 ATCTGCATGTAATTAAAAGTAGG - Intergenic
930891179 2:56389704-56389726 ATCTGCATGCAATTAAAAGTGGG - Intergenic
930903086 2:56532011-56532033 ATTTGCATGTAATTGGAAGTGGG - Intergenic
931202946 2:60118053-60118075 ATTTGTATGTAATTGAAAGAAGG - Intergenic
931506868 2:62938271-62938293 ATCTGCATGGAAGTAATAGTTGG + Intronic
931965438 2:67528698-67528720 ATTTGCATATAATTGGAAATGGG + Intergenic
931972127 2:67600480-67600502 ATTTGTATGTAATTATAAGTGGG - Intergenic
932139823 2:69265414-69265436 ATCTCCATGCAATTAAAAATGGG - Intergenic
932266089 2:70368024-70368046 ATCTAGATGAAATTAAAAGTAGG + Intergenic
932789877 2:74645667-74645689 ATTTGCATGTAATTAAAACTGGG + Intronic
932945762 2:76228442-76228464 ATTTACATGTAATTAAAAAGTGG + Intergenic
932990762 2:76783297-76783319 ATTTGCCTTTAATTTAAAATTGG - Intronic
933032837 2:77354025-77354047 ATTTGCATGTAATTAAAAGTGGG - Intronic
933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG + Intergenic
933941890 2:87251992-87252014 ACTTGCATGTAATTAAAAGTGGG - Intergenic
933951582 2:87334934-87334956 ATTAGCATGTCATTAAAACTGGG + Intergenic
934055551 2:88248522-88248544 ATCTGCATGTAATTAAAAGTAGG - Intergenic
934134479 2:88982533-88982555 ATTAGCATGTCATTAAAAGTGGG - Intergenic
934235827 2:90231247-90231269 ATTAGCATGTCATTAAAAGTGGG + Intergenic
934719933 2:96566825-96566847 ATTTGCATATAATTAAAAGTGGG + Intergenic
934890436 2:98063625-98063647 ATTTGCATATAATTAAAAGTGGG + Intergenic
935120323 2:100178422-100178444 ATTTGCATATAATTGAAAGTGGG + Intergenic
935288432 2:101587849-101587871 ATTTGCACATAATTAAAAGTGGG - Intergenic
935667991 2:105529839-105529861 ATTTGTATGCAATTATAAATGGG - Intergenic
935876615 2:107514630-107514652 ATTTTCATGTAATTAAAAGTGGG + Intergenic
936338332 2:111609577-111609599 ACTTGCATGTAATTAAAAGTGGG + Intergenic
936344940 2:111668279-111668301 ATTTGCATGTAATTAAAAGTGGG + Intergenic
936918086 2:117660628-117660650 GTTTGCATTGAATTAGAAGTTGG - Intergenic
936969102 2:118158941-118158963 ATTTACCTGTAATTATTAGTAGG - Intergenic
937053432 2:118910984-118911006 AGTTACATGTAGTTAAAAGCAGG - Intergenic
938710761 2:133974482-133974504 TTTAGCATATAATTAAGAGTGGG - Intergenic
940115583 2:150204815-150204837 ATTAGAATGTCATTTAAAGTGGG - Intergenic
940123850 2:150300064-150300086 ATATGCATATAATTAAAAGTGGG + Intergenic
940460845 2:153960535-153960557 ATCTGTATGCAATTAAAAATGGG - Intronic
941664814 2:168234128-168234150 CTTTGCATGTTATTAAAAGGTGG + Intronic
941714554 2:168749940-168749962 ATGTGAATGTAATTAAAAGTGGG - Intronic
942002116 2:171658205-171658227 ATTGGCACATACTTAAAAGTTGG - Intergenic
942122819 2:172794937-172794959 ATTTGAATATAATTAAAATGAGG + Intronic
942846541 2:180432827-180432849 ATTAGCATGTCATTAATAGCAGG - Intergenic
943030567 2:182680905-182680927 ATTTACATGTAATTGAAAGTAGG - Intergenic
943127657 2:183815550-183815572 ATTAACAGGTAATTACAAGTTGG + Intergenic
943162065 2:184267508-184267530 ATTTGCATGCATATGAAAGTTGG - Intergenic
943267614 2:185755097-185755119 TTTGGCATGTAATTTACAGTGGG - Intronic
943442910 2:187947978-187948000 ATCTGCATGCAATTAAAAGTGGG + Intergenic
943473022 2:188318749-188318771 ATTTGCATGTAATTAAAAGCAGG + Intronic
943523566 2:188987326-188987348 ATTTATATGTGATTAAAAATAGG - Intronic
943623431 2:190174765-190174787 ATTTGTAAGCAAATAAAAGTTGG + Intronic
943868651 2:192962904-192962926 ATCTACATATAATTAAAATTAGG - Intergenic
943883722 2:193183443-193183465 ATTAGCATATAATTAAGAGTGGG - Intergenic
944435239 2:199681763-199681785 ATTTGTATGTTATTTAAAGTGGG - Intergenic
944529664 2:200655060-200655082 GTGTGCATGTAATTCATAGTTGG - Intronic
944649669 2:201816940-201816962 ATTTGCATATAACTAAAAGTGGG + Intronic
945322652 2:208443298-208443320 ATTTGGATAAAATTAAAAATGGG - Intronic
945612977 2:212029136-212029158 ATCTGCATGTAATTAAAAGTGGG + Intronic
945834052 2:214818078-214818100 AGTTGAACGTAATTAAAACTAGG - Intergenic
946058849 2:216924323-216924345 GTTTGCATATAATTAGAAGTGGG + Intergenic
946520114 2:220455413-220455435 ATTTGAATTTAATTTAAAGATGG + Intergenic
946805878 2:223470996-223471018 ATTTGCATGTAATTAAAAGTGGG - Intergenic
946806662 2:223477333-223477355 ATTTGCATGTAATTAAAAGTGGG - Intergenic
946887854 2:224242121-224242143 ATTTGCATATAATTAAAAATGGG + Intergenic
946928608 2:224650304-224650326 ATTTGCATATAATTAAAATTGGG + Intergenic
947617179 2:231565703-231565725 ATTTGCATGTAATTAAAAGTGGG - Intergenic
948107988 2:235430432-235430454 ATTTGCATGTAATTAAAAGTGGG - Intergenic
948529390 2:238594615-238594637 TTTAGCATATAATTAAGAGTGGG + Intergenic
948675880 2:239596392-239596414 ATCTGCATGCAATTAAAAGTGGG - Intergenic
948762893 2:240203615-240203637 ATTTCTATGTAATTAACAGCAGG - Intergenic
948880526 2:240855055-240855077 ATTTGCATGTCACTAAAAGTGGG - Intergenic
1168884740 20:1240817-1240839 ATCTGCATACAATTAAAAGTGGG + Intronic
1168909423 20:1435254-1435276 ATTTGCATGTAATTAAAAATGGG + Intergenic
1169023109 20:2344890-2344912 AATTCAATGTAACTAAAAGTGGG + Intergenic
1169035421 20:2447178-2447200 ATTTGCATGTAATTGTAAGTGGG + Intergenic
1169271034 20:4199595-4199617 ATTTGCATGTAGTTAAAAGTAGG - Intergenic
1169501856 20:6168216-6168238 ATTTGCATATAATTAAAAGTGGG - Intergenic
1169927179 20:10795290-10795312 ATTTTCTTGGAATTCAAAGTTGG + Intergenic
1170121723 20:12919493-12919515 ATTTGTATGTCATTAAAAGTGGG + Intergenic
1170303017 20:14907219-14907241 ATTTGCATACAATTGAAAGTAGG + Intronic
1170470065 20:16659952-16659974 TTTAGCATGTAAATAAGAGTCGG - Intergenic
1170610783 20:17911108-17911130 ATTCGCATATAATTAACAGTGGG + Intergenic
1170661610 20:18346752-18346774 ATATGCATGTAAGAAAAAGGAGG - Intergenic
1170753694 20:19176783-19176805 ATTTGCATGTAATTATGAGTGGG + Intergenic
1171171008 20:23015398-23015420 ATTTACATGTAATTAAAACTGGG - Intergenic
1171325005 20:24283433-24283455 ATTTGCATGTAGTTGAAAGTAGG - Intergenic
1172199233 20:33113551-33113573 ACTAGCATGTAATTAAAAGTGGG - Intergenic
1172246776 20:33450856-33450878 ATTTGTGTATAATTAAAAGTGGG - Intergenic
1172319625 20:33986204-33986226 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1172388407 20:34549641-34549663 ATTAGGATGTCATTAAAAATGGG - Intronic
1172514799 20:35525850-35525872 ATTTGCATGTAGTTAAAAGTGGG - Intronic
1172570702 20:35968139-35968161 ATTTGCATGTGATTGAAAGTGGG - Intronic
1172582896 20:36062611-36062633 ATTTGCATGTAAATAAAAGTGGG + Intergenic
1172803848 20:37597429-37597451 ATTTGCGTATAATTAAAAATGGG + Intergenic
1173466374 20:43285251-43285273 ATTTGCGTATAACTGAAAGTAGG - Intergenic
1173887007 20:46468589-46468611 ATTTGCATATATTTAAAAGTGGG - Intergenic
1173891982 20:46519809-46519831 ATTTACATGTAATTGAAAGTGGG + Intergenic
1174431182 20:50470510-50470532 ATTAGCATATAATTAAGAGTGGG - Intergenic
1174537440 20:51262310-51262332 GTTTCCATGAAGTTAAAAGTAGG - Intergenic
1174894794 20:54436921-54436943 ATCTGCATGCAATTAAAAGTAGG - Intergenic
1174896016 20:54450835-54450857 ATTTTTATGTATTTAAAAATGGG - Intergenic
1174949316 20:55027366-55027388 ATTAGCATGTCAGTAAAAGTGGG - Intergenic
1174950507 20:55036645-55036667 GTTAGCATGTCATTAAAAGTGGG - Intergenic
1174970301 20:55267556-55267578 ATTTGCATATAATTAAAAGCAGG - Intergenic
1175138119 20:56840183-56840205 ATTTGCATTTAATTAAAAGTGGG - Intergenic
1175138256 20:56841044-56841066 ATCTGCATGCAATTAAAAGTAGG + Intergenic
1175509615 20:59515043-59515065 CTTTGCATGTAATTAAAAGTGGG - Intergenic
1175569392 20:60007526-60007548 ATTTGCATGTAATTGAAAGTGGG - Intronic
1175675436 20:60942722-60942744 ATCTGCATGTTATTAAAAGTGGG + Intergenic
1175709397 20:61206974-61206996 CTTTGCATGTCATTTTAAGTGGG - Intergenic
1175713823 20:61242268-61242290 ATTTGCATGTAACTTAAAAGCGG - Intergenic
1176518023 21:7800886-7800908 ATTTGCATATAATTAAAAGTGGG - Intergenic
1177330971 21:19662221-19662243 ACTTGCAAATAATTAAAAATAGG - Intergenic
1177348930 21:19910018-19910040 TTCTACATGTAATTAAAAGCAGG - Intergenic
1177510439 21:22080060-22080082 ACTTGCAAGCAATTAAAAGGTGG + Intergenic
1177809164 21:25906250-25906272 ATTTGGATGAAATAAAAATTTGG + Intronic
1177955822 21:27597777-27597799 ATATGTATGTAGTCAAAAGTTGG - Intergenic
1177973945 21:27824807-27824829 ACTTGCAAGATATTAAAAGTGGG + Intergenic
1178042347 21:28653030-28653052 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1178240417 21:30893471-30893493 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1178383701 21:32132871-32132893 TTTAACATGAAATTAAAAGTGGG + Intergenic
1178652051 21:34430899-34430921 ATTTGCATATAATTAAAAGTGGG - Intergenic
1178774307 21:35534588-35534610 ATTTTCAGGTAACAAAAAGTTGG + Intronic
1179310148 21:40188200-40188222 ATTTCAGTGTAATTGAAAGTAGG + Intronic
1179414427 21:41186821-41186843 ATTTGCATATAGTTAAAGGTAGG - Intronic
1179427360 21:41292320-41292342 ATTTGCATATAATTAAAAGTGGG - Intergenic
1179477672 21:41658366-41658388 ATCTGCATGCAATGAAAAGTAGG - Intergenic
1180930193 22:19584954-19584976 ATTAGCATGGCACTAAAAGTGGG + Intergenic
1180931303 22:19593690-19593712 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1181447600 22:22990045-22990067 ATCTGCATGTTATTAAAAGTGGG - Intergenic
1181753664 22:25007762-25007784 ACTTGCATGTAATTAAAAGTGGG + Intronic
1181754916 22:25016993-25017015 ATTTGCATATAATTAAAAGTGGG - Intronic
1181770594 22:25122443-25122465 GTCTACATGTTATTAAAAGTGGG + Intronic
1181910014 22:26231190-26231212 ATTTGCATGTAATTAAAAGTGGG - Intronic
1182029601 22:27147478-27147500 ATTTGCATATAATTAAAAGTGGG + Intergenic
1182111091 22:27724272-27724294 ATTTGCATGTAATGAGAAGTGGG - Intergenic
1182186276 22:28405860-28405882 ATTTGCATGTAATTAAAAGTGGG + Intronic
1182192183 22:28473553-28473575 ATTTGCATATAATTAAAAGTGGG + Intronic
1182466016 22:30516767-30516789 GTCCGCATGTTATTAAAAGTGGG - Intergenic
1182971590 22:34584284-34584306 ATTTGCATATAATTAAAAGTGGG - Intergenic
1183336457 22:37250211-37250233 ATTTGCATGTGACTAAAAGTGGG + Intergenic
1183356008 22:37359927-37359949 ATTTGCATGTGATGAAAAGTGGG - Intergenic
1183560078 22:38565493-38565515 ATTTGCACGTAATTAAAAGTGGG + Intronic
1183566923 22:38622150-38622172 ATTTGCCTGTAATTAAAAGTGGG + Intronic
1184434841 22:44464945-44464967 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1184612738 22:45615420-45615442 ATGTACATATAATTAAAAGTGGG - Intergenic
1184632472 22:45793990-45794012 ATTCGCATATAGTTAAAAGTGGG - Intronic
1184866913 22:47206475-47206497 ATTTACATGTAATTAAAAGTGGG + Intergenic
1185006972 22:48285012-48285034 TTTTGCATATAACTAAAAGGGGG + Intergenic
1185131894 22:49044020-49044042 ATTAGCATGTAGTTAAAAGTGGG - Intergenic
1185242920 22:49756007-49756029 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1185300065 22:50074886-50074908 ATTAGCATATACTTAAAAGTGGG + Intronic
949201369 3:1383791-1383813 ATTTGCATGTAATTAGAAGTGGG - Intronic
949255098 3:2036380-2036402 ATTTGCATATAATTAAAAGTGGG + Intergenic
949712280 3:6885329-6885351 ATTTGCATATAATTAAAAGTGGG - Intronic
949737229 3:7187661-7187683 ATCTGCATGTAATTAAAAGTGGG - Intronic
950629741 3:14274565-14274587 ATTTGCATATAATCAAAAGTGGG - Intergenic
950685059 3:14611050-14611072 ATTTGCATGTAATAAAAAGTGGG - Intergenic
950700434 3:14741827-14741849 ATCTATATGTAATTAAAAGCAGG - Intronic
950705271 3:14775604-14775626 TTTAGCATATAATTAAGAGTGGG - Intergenic
950779374 3:15378195-15378217 ATATACAAGTAATTGAAAGTGGG - Intergenic
951641097 3:24836390-24836412 GTTTTCATGTAATTCAAACTAGG - Intergenic
952564454 3:34638200-34638222 ATTTGCATGTAGTTAAAAGTGGG - Intergenic
952822426 3:37496677-37496699 ATTTGCATTTCATTCTAAGTAGG - Intronic
953249932 3:41235943-41235965 ATTTTCATAAAATTAAATGTTGG - Intronic
953308739 3:41855521-41855543 ATTGCCCTGTAATTAAAATTGGG + Intronic
953408188 3:42670675-42670697 ATTTGCATGTAAGTCAAAGTGGG - Intergenic
953638655 3:44685334-44685356 ATCTGCATGCGATTAAAAATGGG + Intergenic
953873133 3:46644995-46645017 ATTTATATATAATTAAAAATAGG - Intergenic
954803502 3:53201366-53201388 ATTTGCATATAATTAAAAGTGGG + Intergenic
955251448 3:57287159-57287181 ATTTGCTCATAATTAAAAATTGG + Intronic
955644083 3:61118146-61118168 ATTTGGAGGTAATAAAATGTTGG - Intronic
955710194 3:61770767-61770789 ATTTTAATACAATTAAAAGTTGG + Intronic
955746372 3:62144543-62144565 AGTTCCATGTAATTAAATGCTGG - Intronic
955803850 3:62713518-62713540 TTTGGCACGTAATTAAAAGTAGG + Intronic
956359653 3:68433487-68433509 ATTAAAATGTAATTTAAAGTGGG - Intronic
956489982 3:69760511-69760533 ATTTGCATGTAATTCCAAGTGGG - Intronic
956983903 3:74674208-74674230 ACTTGAATCTAATTAAAACTTGG - Intergenic
957056262 3:75445146-75445168 ATCTGCATACAATTAAAAGTGGG - Intergenic
957415353 3:79895165-79895187 ATTTGCATGTAATTAAAAGTGGG + Intergenic
958572279 3:95902052-95902074 ATTTTTATGTAATTAAATTTTGG + Intergenic
958595352 3:96215735-96215757 ATGTGCATGTAATTATAGGTGGG - Intergenic
958798518 3:98731879-98731901 ACTTGGATGTAATTCAAAGTTGG - Intergenic
958820775 3:98971189-98971211 ATTGGCATGTAATTTAGAGAAGG - Intergenic
959061904 3:101623732-101623754 ATTTCCATATAATTAAAAGTGGG - Intergenic
959129557 3:102337346-102337368 ATGTACATGTAATTAAAAGTAGG + Intronic
959266225 3:104142299-104142321 ATTTGCATTTGATTAAAAGGGGG + Intergenic
959333042 3:105030603-105030625 ATTTGCATATAATTAAAAGTGGG + Intergenic
959458331 3:106591766-106591788 ATTTGCATATAATTAAAAATGGG + Intergenic
959640338 3:108625429-108625451 ATATGTATGTATTTAAAAGATGG + Intronic
959780542 3:110227628-110227650 ATTTGCATGTAATTAAAAGTGGG + Intergenic
959876851 3:111393189-111393211 ATTTGCATGTAATTGAAAGTAGG + Intronic
960640921 3:119821976-119821998 ATTTGCATTAAATAAAAAGTAGG - Intronic
961061978 3:123836398-123836420 ATTTGTATTTAAGAAAAAGTGGG - Intronic
961107813 3:124257186-124257208 ATATGCATTTAATAAATAGTAGG - Intronic
961298125 3:125903561-125903583 ATCTGCATGCAATTAAAAGTGGG + Intergenic
961503571 3:127355280-127355302 ATTTGCATGTAATTAAAAGTGGG - Intergenic
961527234 3:127512905-127512927 ATTTGCATGTAATTAAACATGGG + Intergenic
962090212 3:132236333-132236355 ATTTGCATTTACTTATAATTAGG - Intronic
962260942 3:133905540-133905562 ATCTGCATGCAATTAGGAGTGGG - Intergenic
962275367 3:134009405-134009427 ATTTGCATGTATTTTATAGATGG + Intronic
962822625 3:139066577-139066599 ACTTGTATGTATTTATAAGTTGG + Intronic
963072206 3:141313442-141313464 ATCTGCATGCAATTAAAAATAGG + Intergenic
963162539 3:142166376-142166398 ATATGCATAAAATTCAAAGTTGG + Intronic
963234159 3:142939341-142939363 GTTTCAATATAATTAAAAGTTGG + Intergenic
963429518 3:145180975-145180997 ATCTACATGCAATCAAAAGTGGG - Intergenic
963594302 3:147305438-147305460 ATGTGCATGCATTTAAGAGTAGG - Intergenic
963726093 3:148923221-148923243 ATTCGCATATAATTAAAAGCAGG - Intergenic
963811762 3:149784396-149784418 ATTGGCTCGTAATTCAAAGTTGG - Intronic
964197296 3:154079517-154079539 ATTTGCACATAATTAAAAGTGGG - Intergenic
964340012 3:155698545-155698567 ATTAGCCTGTGTTTAAAAGTAGG + Intronic
964722616 3:159782223-159782245 ATGGGCATCTAATGAAAAGTAGG - Intronic
964785431 3:160391035-160391057 ATTTGCATATAGCTAAAAGTGGG + Intronic
964950139 3:162280882-162280904 TTTTGCATGTGGTTAAAGGTAGG + Intergenic
964978091 3:162643818-162643840 ATTTTCATATAATTAAAATTGGG - Intergenic
965178882 3:165374532-165374554 ATTTTGATGTCATTAATAGTGGG + Intergenic
965805436 3:172536887-172536909 GTTTGCATTTTATTATAAGTTGG + Intergenic
965969877 3:174542026-174542048 ATTTGCACAGAATTAAAAATGGG - Intronic
966049393 3:175595167-175595189 TTTTGTATATAGTTAAAAGTAGG + Intronic
966072567 3:175896453-175896475 ATTTGCATATAATTTAAAGTGGG + Intergenic
966176344 3:177142348-177142370 GTTTGCGTGTAATTAAGAGTAGG - Intronic
966414837 3:179677989-179678011 AGTTGCATGAAATTTAAAGGGGG - Intronic
966640610 3:182185582-182185604 ATTTGCATGAGATTAGAAGAGGG + Intergenic
966696004 3:182791655-182791677 ATTTGCAGATGAATAAAAGTAGG + Intergenic
966901286 3:184487931-184487953 TTTTGTATGTAGTGAAAAGTAGG + Intronic
967567660 3:190990970-190990992 ATATGCTTGCAATTAAAGGTAGG - Intergenic
967620499 3:191627943-191627965 ATTTGTATGTAATTAAAAGTGGG + Intergenic
967843604 3:194027264-194027286 ATTTGCATATAGTTAAAGGTGGG - Intergenic
968600117 4:1504708-1504730 ATTTGCATATCATTAAAAGTGGG - Intergenic
969191521 4:5524918-5524940 ATTAGCATATAATTAAAAGTGGG - Intronic
969218462 4:5742987-5743009 ATTTGCATGTAATTGAAAGTGGG - Intronic
969356835 4:6632923-6632945 ATTTTCACATAATTAAAAGTGGG - Intergenic
969359105 4:6650178-6650200 ATTTGCATGTAATTAAAAGTGGG + Intergenic
969426071 4:7124716-7124738 ATCAGTATGCAATTAAAAGTGGG - Intergenic
969754928 4:9143207-9143229 ATCTGCATGCAATTAAAAGTGGG + Intergenic
969814830 4:9679490-9679512 ATCTGCATGCAATTAAAAGTGGG + Intergenic
969974856 4:11088092-11088114 ATTTGCGTCTAAATAAAATTTGG - Intergenic
970069006 4:12134451-12134473 ATTTTGATGTAATTATAAGTGGG - Intergenic
970073209 4:12186837-12186859 ATTTGCATGCAATTAAAAGTGGG - Intergenic
970076624 4:12229242-12229264 TTTTTCATGCAATGAAAAGTTGG + Intergenic
970460702 4:16272189-16272211 ATGTGCATGCAATTAAAATATGG + Intergenic
970877352 4:20886455-20886477 ATTTGTGTGAAATTAAATGTGGG + Intronic
971837136 4:31782114-31782136 ATATCTATGTAATTAAAAATGGG + Intergenic
971911040 4:32798238-32798260 ATCTACATGTAATTAAAAGCAGG + Intergenic
972381415 4:38523649-38523671 ATTTCCAAGGAAGTAAAAGTGGG + Intergenic
972413018 4:38811619-38811641 ATCTGCATGCAATTAAAAGTGGG + Intronic
972811489 4:42592417-42592439 ATTTGTATTTAATTTTAAGTTGG - Intronic
973148515 4:46859840-46859862 ATTTGCATGTAATTAAAAGTGGG + Intronic
975093328 4:70428121-70428143 AACTGCATGCAATTAAAAATGGG + Intergenic
975445662 4:74462271-74462293 ATATACATGTAATTTAAAGGTGG + Intergenic
975780709 4:77836874-77836896 ATTTAAATGTAATTATAAATAGG - Intergenic
975909946 4:79255852-79255874 ATCTGCATGCCATTAAAAGTGGG - Intronic
975966311 4:79976562-79976584 ATTTTCATATAATTAAAAGTGGG + Intronic
976083447 4:81382211-81382233 CTTTGCATGTAATTTTAATTGGG + Intergenic
977065463 4:92307487-92307509 ATTTTCATGTATATATAAGTTGG - Intronic
977147734 4:93466500-93466522 ATCTGCATGCAGTTAAAAGTGGG - Intronic
977825275 4:101523948-101523970 ATTTGTATGTGATTGAAAGTGGG + Intronic
977885373 4:102246891-102246913 ATTTGTCTGAAATTAAAAGCAGG - Intergenic
978091534 4:104723016-104723038 ATTTACATGAAGTTAAAAATAGG + Intergenic
978900710 4:113946291-113946313 ATTTGCAAGTCATTAAAACATGG - Intronic
979140268 4:117163257-117163279 ACTAGTATGTAATTAACAGTTGG - Intergenic
979407722 4:120334328-120334350 ATTTTTATGTAGGTAAAAGTTGG - Intergenic
979511222 4:121556069-121556091 ATTTGCATGTAATTAAAAGCAGG + Intergenic
979647891 4:123093303-123093325 ATTTGCATGTAAATGAAAGTGGG - Intronic
980314662 4:131182116-131182138 ATTAGCATGTAATTAGAAGTAGG + Intergenic
980334920 4:131459821-131459843 ATTAGCATATACTTAAAAGAGGG + Intergenic
980346293 4:131625189-131625211 ATTAGCATGTCAATAAAAGTTGG - Intergenic
981041482 4:140226828-140226850 ATTTTCAGGAAATTAAAAGTTGG + Intergenic
981118152 4:141016425-141016447 ATTAGCATGTCATTAAAAGCAGG + Intronic
981916524 4:150039901-150039923 ATTAGCATGTCATTAAAAGTGGG - Intergenic
982378871 4:154726320-154726342 CTTTGCATGTAATTGCTAGTGGG - Intronic
982416516 4:155139731-155139753 AATTGCAGGGAACTAAAAGTAGG - Intergenic
982578043 4:157142300-157142322 AGTTGAATTTAATTAAAATTAGG - Intronic
982652443 4:158103166-158103188 ATTTGCACATAATTAAAAGTTGG - Intergenic
984077778 4:175205182-175205204 ATCTACATGTAAATAAAAGTAGG - Intergenic
984095946 4:175434306-175434328 ATTTTCATAATATTAAAAGTTGG + Intergenic
984151053 4:176130943-176130965 ATATTTATGTAATTGAAAGTAGG + Intronic
984274816 4:177597094-177597116 ATTTGCATGTAGTTAAAAGTGGG - Intergenic
984329848 4:178300266-178300288 ATGTCAATGTACTTAAAAGTAGG - Intergenic
985690901 5:1311727-1311749 GTCTACATGTAATTAAAAGTGGG - Intergenic
985700470 5:1368867-1368889 AGTTGCACGTAATTGAAAGCGGG + Intergenic
986201804 5:5586030-5586052 ATTTGCAGGTAATTGAAAGTGGG - Intergenic
986209502 5:5657372-5657394 AATTGCATGTAGTTGAAAATGGG + Intergenic
986607991 5:9541771-9541793 TTGTGCATGAAATTTAAAGTAGG - Intronic
987163205 5:15166640-15166662 GTTTGTATATAATTAAAAGTGGG + Intergenic
987197730 5:15544051-15544073 ATTTGCATGTAATTAAAAGTGGG + Intronic
987496938 5:18658244-18658266 ATCTGCATGCAATTAAAAGTGGG - Intergenic
987872407 5:23637887-23637909 ATCTGGAGATAATTAAAAGTGGG + Intergenic
988226054 5:28412434-28412456 ATTTGCATATGATTGGAAGTTGG - Intergenic
988391165 5:30633675-30633697 ATATGTATCTAATTAAAATTGGG - Intergenic
988936634 5:36090032-36090054 ATTTGCATGTAATTGAAAGTGGG - Intergenic
988996473 5:36719789-36719811 ATTTGTATGCAATGAAAAGTAGG + Intergenic
989311321 5:40022094-40022116 GTTTGCATGCAATTGAAAGTGGG - Intergenic
990511379 5:56492393-56492415 GTCTACATGTAATTAAAAGCAGG - Intergenic
990530164 5:56665759-56665781 TTTTGCATATAGTTAAAGGTAGG + Intergenic
990647200 5:57858121-57858143 ATTTACAGGTAATTGAAAGCAGG - Intergenic
990658643 5:57987081-57987103 ATCTACATATAATTAAAAGTAGG + Intergenic
991004359 5:61813142-61813164 GTTGGCATGAAATTAAAAGTGGG - Intergenic
991124110 5:63050323-63050345 TGTTGCATTTAATTAAAAGTAGG - Intergenic
991944422 5:71885732-71885754 ATTTGCATGTAATTAAAAGTGGG - Intergenic
992354429 5:75966612-75966634 ATTTGCATGTAATTAAAAGTGGG + Intergenic
992508465 5:77410292-77410314 ATTTGCATGTAATGAAAAGTAGG - Intronic
993100266 5:83529890-83529912 ATTTTCCTGTACTTAGAAGTTGG - Intronic
993326842 5:86550216-86550238 GTTTCCATATAATTAACAGTGGG - Intergenic
993335210 5:86648864-86648886 ATTTTAATATCATTAAAAGTAGG + Intergenic
993588696 5:89765753-89765775 ATGGGCATGTACTTAGAAGTGGG + Intergenic
993783443 5:92098196-92098218 ATTTGCCATTATTTAAAAGTTGG + Intergenic
993852068 5:93023104-93023126 ATGTTCATTAAATTAAAAGTAGG + Intergenic
994223547 5:97225276-97225298 TTTTACATATAATTAAAAATGGG + Intergenic
994238290 5:97391314-97391336 ATTTGCATGTAATTGAAAGTGGG + Intergenic
994238803 5:97395780-97395802 ATTTACACATAATTATAAGTGGG + Intergenic
994281350 5:97907141-97907163 ATTTGCATATATATAAAAATTGG + Intergenic
994801290 5:104380430-104380452 ATTTGCATATAATTAAAAGTGGG + Intergenic
994905528 5:105837762-105837784 ATTTGCATAAAATTAAAAGTGGG + Intergenic
994968614 5:106706713-106706735 ATTAGCATAAAATTGAAAGTAGG - Intergenic
995199840 5:109413602-109413624 ATTAGCATATAATTAAAAGTGGG - Intergenic
995287462 5:110407596-110407618 ATCTGCCTGTAACTAAGAGTGGG - Intronic
995370475 5:111412894-111412916 ATTTATATGTAATTAAAAGTGGG + Intronic
995433355 5:112107153-112107175 ATTAGCATGTAATTTATATTGGG - Intergenic
995840192 5:116436652-116436674 ATCTGCATGCAATTACAAGTGGG + Intergenic
995954890 5:117765738-117765760 ATATGGATGTGATTAAATGTGGG + Intergenic
995963383 5:117873089-117873111 ATTAGCATATAATTTAGAGTAGG - Intergenic
996303289 5:122015451-122015473 ACTTGCATGTAATTTAGAGCAGG + Intronic
996335132 5:122375913-122375935 ATCTGCACTTAATTAAAAGATGG - Intronic
996528795 5:124505351-124505373 AATTACATATCATTAAAAGTAGG - Intergenic
996573749 5:124960579-124960601 ATTTGCATATAATTAAAATTCGG - Intergenic
996629060 5:125606081-125606103 ATCTGCATACAATTAAAAGTAGG + Intergenic
996930516 5:128880909-128880931 ATTTGCATGTAATTAAAAGTCGG - Intronic
997044469 5:130297533-130297555 ATTTGCATTGAATTTTAAGTAGG - Intergenic
997065232 5:130551732-130551754 ATTTGCATATAATTAGAAGTGGG + Intergenic
997065373 5:130553538-130553560 ATTTGCATGCAATTGAAAGTGGG + Intergenic
997070566 5:130617640-130617662 ATCTGCATGTAGTTAAAAGTGGG + Intergenic
997408741 5:133673650-133673672 ATTTGCATAGAATTAAAGTTTGG - Intergenic
997789552 5:136745005-136745027 ATTTGCATGTTTTTAAATTTTGG - Intergenic
998323084 5:141250970-141250992 ATTTGCATGTAAGTGAAAATAGG + Intergenic
998517268 5:142768014-142768036 ATTAGCATATAATTAAAGGTAGG - Intergenic
998685582 5:144520627-144520649 TTCTGCATATAATTTAAAGTAGG + Intergenic
999034599 5:148333499-148333521 ATTTGCATATAATTAAAAGTGGG - Intronic
999190930 5:149746921-149746943 ATTTGCCTGTATTTTAAAATTGG + Intronic
999407155 5:151316765-151316787 AGATCCATATAATTAAAAGTCGG + Exonic
999541575 5:152580289-152580311 TTTTGCATATTATAAAAAGTAGG + Intergenic
999541924 5:152583999-152584021 ATTTACATGTAATGGATAGTAGG + Intergenic
1000520893 5:162293375-162293397 ATCTACATGTAATTAAAAGTAGG + Intergenic
1000543566 5:162570511-162570533 ATTTGCATGTAATTAAAAGTAGG + Intergenic
1000593450 5:163186275-163186297 ATTTGCATGTAATTGAAAGTGGG + Intergenic
1000646504 5:163766370-163766392 ATTTGCATATAATCAAAAGTGGG - Intergenic
1000735674 5:164896500-164896522 ATTTGAATATAATCAAAAGTTGG + Intergenic
1000837403 5:166172865-166172887 ATCAGCATGTTATGAAAAGTCGG - Intergenic
1000898322 5:166883227-166883249 ATTTCCATCTAAATAACAGTAGG - Intergenic
1001437482 5:171711594-171711616 ATTTGCATATAAATAAAAGTGGG - Intergenic
1002463932 5:179394509-179394531 ATTTGTGTATAATTAAAACTGGG + Intergenic
1003043813 6:2714363-2714385 ATTTGCATGTAATTGAAAGTGGG + Intronic
1003378112 6:5597781-5597803 ATTTGTATGTTTTTAAAAATTGG - Intronic
1003522888 6:6873756-6873778 ATTTGGATGTGGTCAAAAGTGGG - Intergenic
1003652490 6:7974371-7974393 GTCTGTATATAATTAAAAGTGGG - Intronic
1003787348 6:9501411-9501433 ATTAGCGTGTCATTAAAAGTGGG + Intergenic
1003924237 6:10861882-10861904 ATTTGCATATAATTAAAATGAGG + Intronic
1004035456 6:11918752-11918774 AAAAGCATGTAATTAAAAGCTGG + Intergenic
1004554931 6:16687086-16687108 ATTGGCATGTAATTACAACCAGG + Intronic
1004840402 6:19577447-19577469 ATTTGCATGTAATTAAAAGTAGG - Intergenic
1005567930 6:27115173-27115195 ATTAGCATATAATTAATAGTGGG - Intergenic
1005686082 6:28254289-28254311 ATTTGCATATAATTAAATGTAGG - Intergenic
1006199624 6:32276592-32276614 ATTGGCATATGATTGAAAGTGGG - Intergenic
1006417740 6:33914646-33914668 ATTGGCATGTGATCAAAAGTGGG + Intergenic
1006722098 6:36162149-36162171 ATTTGCATGTACTTTAAAGTGGG + Intergenic
1006948468 6:37801312-37801334 ATTTGGATCTAATTAAAGGATGG - Intergenic
1008146887 6:47902673-47902695 ATTTATATGTAATTAAAAGGAGG - Intronic
1008206914 6:48671539-48671561 ATTTGCATGTTATTGAAAGTGGG - Intergenic
1008688881 6:53955586-53955608 ATTTGCATGTTTTTTAAAATTGG + Intronic
1008842310 6:55918321-55918343 ATTTAAATATAATTAAAATTTGG + Intergenic
1009301044 6:62021151-62021173 ATTTGGATTTAATAATAAGTGGG - Intronic
1009698020 6:67134776-67134798 ATTTGTAGGTAATTAACATTAGG - Intergenic
1009757034 6:67953524-67953546 ATTTGCATATAATCAGAAATGGG - Intergenic
1009829878 6:68916579-68916601 CTTTGCAAATAATTAAAATTTGG + Intronic
1010675920 6:78742779-78742801 ATTTGCATGCAATTGTAAGTGGG + Intergenic
1010866612 6:80983364-80983386 CTTTATATGTAATTAAAAGTGGG + Intergenic
1010870143 6:81026706-81026728 ATTTGTATGTAATTAAAAGTAGG - Intergenic
1011178599 6:84593096-84593118 ATTTGCATATAATTAAAAGTGGG - Intergenic
1011545399 6:88477411-88477433 ATTTACATATAATTGAAAGTGGG - Intergenic
1011728116 6:90231206-90231228 AGTTGTATGTAATGAAAATTTGG - Intronic
1011742088 6:90372273-90372295 ATATGCCTATAATTAAATGTAGG + Intergenic
1011830011 6:91360389-91360411 ATTTTCATGTAAGTAAAATGGGG - Intergenic
1012665976 6:101970492-101970514 ATTTTCATATAATAAAAAGTGGG - Intronic
1012772358 6:103454971-103454993 ACTTGCATGTAATTAAAAGCGGG + Intergenic
1012786607 6:103636864-103636886 ATTTGCATGTAATTTATTTTAGG + Intergenic
1013363061 6:109412187-109412209 AATCTCATGCAATTAAAAGTGGG + Intronic
1013415270 6:109919106-109919128 ATTAGAATGTAATTATAATTTGG + Intergenic
1013420682 6:109963898-109963920 TTTTGCATGTAATTAAAAGTGGG + Intergenic
1013509375 6:110830558-110830580 ATTTGCATGTGATTAAAACTGGG + Intronic
1013708267 6:112865373-112865395 ATTAGCATGTCATTAAAAGTGGG - Intergenic
1013904935 6:115204588-115204610 ATTTGTATGTACTTAAGAGTTGG - Intergenic
1014533187 6:122585040-122585062 ATTTGCATATAATTAAAAGTGGG + Intronic
1014592333 6:123289675-123289697 ATCTTCATGCAATTGAAAGTGGG + Intronic
1014592994 6:123295255-123295277 ATATGCATGCAATTAAAAGTGGG + Intronic
1014653148 6:124066279-124066301 ATATGAATGTAATTATCAGTAGG - Intronic
1014916804 6:127160575-127160597 ATTTGCATCTAATTAAAAGTGGG - Intronic
1014934172 6:127366711-127366733 ATTTTAATATAATTAACAGTGGG - Intergenic
1015408751 6:132867960-132867982 ATTGGCATGAAATTTAAAGCAGG - Intergenic
1015479240 6:133689931-133689953 ATTTGGATGCAGTTAAAAGTGGG - Intergenic
1015560679 6:134511927-134511949 AATTGCATGTCATTTAAAATAGG - Intergenic
1015771345 6:136771565-136771587 ATCTGCATGCAATTAAAAGTAGG + Intronic
1016053697 6:139556408-139556430 TTTTGCATCTAATTCATAGTGGG + Intergenic
1016204132 6:141452599-141452621 ATCTGGATGTTATTAAAAGTAGG - Intergenic
1016239160 6:141908355-141908377 GTTTGCATGCACCTAAAAGTAGG - Intergenic
1016274404 6:142331885-142331907 ATTTGCATCTCACTAAAAGATGG - Intronic
1016392286 6:143586637-143586659 ATCTTCATGCAATTAAAACTGGG - Intronic
1016519571 6:144931437-144931459 ATTCACATGTAACTGAAAGTGGG - Intergenic
1016548060 6:145246362-145246384 ATTTGCATATAATTAAAAGTGGG + Intergenic
1017053251 6:150413914-150413936 ATCTGTATGTAATGAAAAGTGGG - Intergenic
1017385510 6:153878340-153878362 GTTTGCATGAAATTAAAAGTGGG - Intergenic
1017736490 6:157369521-157369543 ATCTGCATGTAATTAAAAGTGGG + Intergenic
1018080236 6:160253295-160253317 ATTTGCATATAATTAAACGTGGG - Intronic
1018089754 6:160335597-160335619 ATTGAAATGTAATTTAAAGTTGG + Intergenic
1018158519 6:161013765-161013787 ATTTACATGTAATTGAAAACAGG - Intronic
1018262705 6:161986179-161986201 ATCTGCATGTAATTACAAGTAGG + Intronic
1019029082 6:168995020-168995042 ACTTGCATGTAATTAAAAGTGGG - Intergenic
1019355746 7:577934-577956 ATGTGCACATAATTTAAAGTGGG - Intronic
1019674186 7:2301564-2301586 GTTTGCATATAATTAAAAGTAGG - Intronic
1019954330 7:4401406-4401428 ATTTGCAGGTAATTAAAAGTGGG - Intergenic
1020776823 7:12464666-12464688 ATTTTCATATAAGTAAAACTGGG + Intergenic
1020782033 7:12529925-12529947 ATTTGCATGTAGTTAAAAGTGGG - Intergenic
1020856784 7:13437087-13437109 ATTTGTATGTAATTAAAATTGGG - Intergenic
1021563503 7:21992709-21992731 ACCTGCAAGCAATTAAAAGTAGG + Intergenic
1021650306 7:22826658-22826680 ATCTACATGTAATTAAAAGTAGG - Intergenic
1021650431 7:22827827-22827849 ATTTGCATATAATTAAAACTGGG + Intergenic
1022007664 7:26281023-26281045 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1022299471 7:29089704-29089726 ATCTGCATGTAATTAAAAGTGGG + Intronic
1022624087 7:32016085-32016107 ATTTGTATATAGTTAAAGGTGGG + Intronic
1022687804 7:32612928-32612950 ATTTGCGTATAATTAAAAGTGGG - Intergenic
1023068309 7:36401980-36402002 ATGTGCATGCAATTAAGAGTAGG + Intronic
1023272481 7:38479503-38479525 CTTTTCAAGCAATTAAAAGTAGG - Intronic
1024187707 7:46970105-46970127 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1024405654 7:48976377-48976399 ATCTGCACGTTATTAAAAGTGGG - Intergenic
1024435040 7:49342204-49342226 ATTAGCATATAAGTAAAAGTGGG + Intergenic
1024652686 7:51419164-51419186 ATTAGCATCTAATTAAGAGTGGG - Intergenic
1024718383 7:52106756-52106778 ATCTACATCCAATTAAAAGTTGG - Intergenic
1024747676 7:52427188-52427210 ATTTGCATGTAATTGTAAGTCGG + Intergenic
1024780892 7:52847032-52847054 ATTTGAATATAATTGAAAGTTGG + Intergenic
1025037866 7:55609803-55609825 ATTAGCATCTAATTAAGAGTGGG - Intergenic
1026009493 7:66625796-66625818 ATTTGCATATAATTAAAAGTTGG + Intergenic
1026128052 7:67596894-67596916 ATTTGAATGTAATTAAAAGGGGG - Intergenic
1026222886 7:68415683-68415705 ACCAGCCTGTAATTAAAAGTGGG + Intergenic
1026357311 7:69569865-69569887 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1026535102 7:71232739-71232761 ATTTGCGTGTAATTAAAAGTGGG - Intronic
1026544741 7:71312114-71312136 ATTTGCATGGTATTAAAAAGTGG + Intronic
1026664695 7:72332274-72332296 ATTTGCCTGTAACTAAAAGTGGG - Intronic
1026674302 7:72416257-72416279 ATTTGCATATAATTAGAAGTGGG + Intronic
1026816791 7:73519897-73519919 ATTCGAATGTATTAAAAAGTAGG + Intronic
1026877730 7:73889179-73889201 ATTTGCATATAATTGAAAGTGGG + Intergenic
1027127382 7:75566439-75566461 ATTTACATATAATTAAAAGTGGG - Intronic
1027355334 7:77348684-77348706 ATATGTATGTAGTTAAAACTAGG - Intronic
1027581464 7:80001457-80001479 ATTTGCATGTAAATATATGGGGG - Intergenic
1027797193 7:82710503-82710525 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1027846463 7:83383621-83383643 ATTTGAATGTAGTTGAAAATAGG + Intronic
1028026557 7:85849214-85849236 ATTTCCATGAAAATAAAAGTTGG - Intergenic
1028075063 7:86502497-86502519 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1029094266 7:98072678-98072700 ATTTGCATATAGGTAAAAGTGGG - Intergenic
1029150696 7:98478303-98478325 ATCTATATGTAATTAAAAGTAGG + Intergenic
1029161210 7:98553433-98553455 ATTTGCAGGTAATCAAAAGTGGG + Intergenic
1029197764 7:98818320-98818342 ATTTGCCTATAATTAAACGTGGG - Intergenic
1029350181 7:100007893-100007915 ATCTACACGTAATTAAAAGTAGG - Intergenic
1029427654 7:100506616-100506638 ATTTGCATATAATTAAAAATGGG - Intergenic
1029577377 7:101412342-101412364 ATTTGCATACAATTAAAAGTGGG + Intronic
1029600310 7:101559400-101559422 ATCTGCATGCAATTAAAAGTAGG - Intergenic
1029817928 7:103115808-103115830 ATTTACATATAATTAAAAGTGGG - Intronic
1030221349 7:107102372-107102394 TTTAGCATATAATTAAGAGTGGG + Intronic
1030222211 7:107109033-107109055 TTTAGCATGTAATTAAAAGTGGG - Intronic
1030242306 7:107341851-107341873 TTTTGCATATAATAAAAGGTAGG - Intronic
1030364884 7:108634342-108634364 ATTTGCATATCATTAAACGAAGG + Intergenic
1030542589 7:110850444-110850466 ATTTACATATAACTGAAAGTGGG + Intronic
1030776769 7:113543334-113543356 ATTTGCATATAATTGAAAGTGGG + Intergenic
1030785517 7:113656273-113656295 ATTTTAATGTAGTTAAATGTAGG - Intergenic
1031325792 7:120395630-120395652 CTTAGCATATAATTAGAAGTGGG - Intronic
1031438750 7:121765670-121765692 ATGAGCATGGAAATAAAAGTGGG + Intergenic
1031623735 7:123968232-123968254 GTTTGCGTATAATTATAAGTGGG - Intronic
1031668130 7:124510823-124510845 ATTTGCTTGTAACTGAAAGTGGG - Intergenic
1031682684 7:124694056-124694078 ATATTCATGTAATTCACAGTTGG - Intergenic
1031805416 7:126301468-126301490 ATTAGCATATAATTAAGAGTGGG + Intergenic
1031823698 7:126535558-126535580 CTCTGCATGCAATTGAAAGTAGG - Intronic
1031892329 7:127309139-127309161 ATTTGCATATAATTAAAAGGGGG + Intergenic
1032526845 7:132584215-132584237 ATTTTCTTTTAATTAAAAGGTGG - Intronic
1033434827 7:141323595-141323617 ATTAACTTGTAATTAACAGTTGG + Intronic
1033527281 7:142228773-142228795 ATTTACATGTGATTAAAAGTAGG - Intergenic
1034048782 7:147959604-147959626 ATCTACATGTAATTCAAGGTCGG - Intronic
1034110000 7:148527626-148527648 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1034347307 7:150395406-150395428 GTTTACATGTAATTAAAAGTAGG - Intronic
1034383994 7:150722759-150722781 ATTTGCATATAGTTGAAAGTGGG - Exonic
1034707340 7:153157300-153157322 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1034974012 7:155437443-155437465 ATTTGCATATAATTAAAAGTGGG - Intergenic
1035819923 8:2580150-2580172 ATTTGCATATAATTAAACACAGG - Intergenic
1036137263 8:6173740-6173762 ATCTGCATGCTATTAAAAGTGGG + Intergenic
1036378161 8:8218522-8218544 ATCTGCATGCAATTAAAAGTGGG + Intergenic
1036386898 8:8289865-8289887 ATTTGCATGTACCTTAAATTTGG - Intergenic
1036674133 8:10815609-10815631 TTTTGCATGCAATTTAAAGGAGG + Intronic
1036732292 8:11276573-11276595 ATTTGCATGTAATTAAAAGTAGG + Intergenic
1036913063 8:12775101-12775123 ATTAGCATATCATTGAAAGTGGG + Intergenic
1036926630 8:12913280-12913302 ATTCGCATGTAATCAAAAGTAGG - Intergenic
1037053513 8:14406786-14406808 ATTTGAAAATAATTAAAAGTGGG + Intronic
1037081986 8:14798128-14798150 ATTTCCATGTCATTATTAGTTGG + Intronic
1037108157 8:15135926-15135948 ATTTGCATATAATTAAAAGTAGG - Intronic
1037247925 8:16857991-16858013 ATCTACATGTAATTAAAAGTAGG - Intergenic
1037251892 8:16905166-16905188 TTCTGTATTTAATTAAAAGTAGG + Intergenic
1037279847 8:17227296-17227318 ATTTGTATGGAACTACAAGTGGG - Intergenic
1037383114 8:18309411-18309433 ATTCGGATGTAATTAGAACTGGG - Intergenic
1037471467 8:19215444-19215466 ATTTACATATAATTGAAAGTGGG + Intergenic
1037530682 8:19769816-19769838 ATTTGCATGTCATTAAAAGTGGG + Intergenic
1037715996 8:21400783-21400805 ATTTGCATTTAATTAAAAGTGGG - Intergenic
1038223402 8:25632102-25632124 ATCTGCATGTAACTAAAAGTAGG - Intergenic
1038289732 8:26238044-26238066 ATCTGCATGCGATTAAAAATAGG + Intergenic
1038375200 8:27033137-27033159 ATTTGCATGCAATTGAAAGTGGG - Intergenic
1038448987 8:27626797-27626819 ATTTGCATATAATTAAAAGTGGG + Intergenic
1038490926 8:27970532-27970554 ATTTGCATATAATTAAAAATGGG + Intronic
1038506507 8:28089545-28089567 ATTTGAATACAGTTAAAAGTGGG - Intergenic
1038542958 8:28404159-28404181 TGTTACATGTAATTGAAAGTAGG + Intronic
1039157657 8:34579717-34579739 ATTTGCATATAATTCAAAGTGGG + Intergenic
1039324988 8:36475197-36475219 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1039375288 8:37026672-37026694 ATTTGCATATAACTAAAACTGGG + Intergenic
1040011413 8:42664099-42664121 ATTTGGATGTCATTAAAAGTGGG + Intergenic
1040018081 8:42716562-42716584 ATTTGCATATAATTAAAGGTGGG - Intronic
1040353363 8:46590707-46590729 ATTTGGATATAATTAAATATGGG - Intergenic
1040856960 8:51958425-51958447 GTTTGCATACAATTAAAAGTAGG - Intergenic
1040939592 8:52818605-52818627 ATCCACATGTAATTAAAAGTAGG + Intergenic
1041499405 8:58523628-58523650 ATTCGCATATAATTAAAAGTGGG + Intergenic
1041840669 8:62266848-62266870 ATTTGTATATAATTAAAAGCAGG + Intronic
1041849707 8:62377132-62377154 ATTCGCATTTAATTAGAACTGGG + Intronic
1042156655 8:65851379-65851401 ATTTGCATATAATTAAAAGTGGG + Intergenic
1042365925 8:67936215-67936237 ATTTGAATATAATCATAAGTAGG - Intergenic
1042518504 8:69684622-69684644 TTTTGTATATAATTAATAGTGGG + Intronic
1042746872 8:72118085-72118107 ATTTGCATGTAATAAAAATTGGG + Intronic
1042818714 8:72906944-72906966 ATTTGCTTGGAAGTAAAAATAGG + Intronic
1042882969 8:73514879-73514901 AATTGATTATAATTAAAAGTTGG - Intronic
1042918153 8:73895571-73895593 ATTTTAATGTCAGTAAAAGTGGG + Intergenic
1043654405 8:82643698-82643720 TTTTGCATGTAATTAAAACTGGG - Intergenic
1044252421 8:90019481-90019503 ATTTGCAGGCAATTAAAAGTGGG - Intronic
1044516413 8:93143917-93143939 ATTGGCATGAAATGATAAGTAGG + Intronic
1044564805 8:93651530-93651552 ATTTGCATGTAATTAAAAGTGGG - Intergenic
1044685411 8:94821700-94821722 ATCTGCATGCAATTAAAAGTGGG + Intronic
1044903815 8:96978008-96978030 TTTTACATGTAATTAAAAAAAGG - Intronic
1044962788 8:97547177-97547199 AATTGCATATGATTAAAAGTTGG + Intergenic
1045010726 8:97956476-97956498 ATCTGCATGCAGTTAAAAGTGGG - Intronic
1045160280 8:99533919-99533941 ATTAGGAAGAAATTAAAAGTTGG - Intronic
1045534511 8:103014493-103014515 ATCTGAATGCCATTAAAAGTGGG + Intergenic
1045624172 8:104022980-104023002 ATTTACCTGTAATTAAGATTTGG + Intronic
1045843900 8:106610795-106610817 ATTTGCATCTAATTATTGGTTGG - Intronic
1046590714 8:116202897-116202919 ACTTGTATATAATTAAAATTTGG + Intergenic
1047173871 8:122521984-122522006 ATTTGCATGTAGATAGAAGAGGG - Intergenic
1047280744 8:123443322-123443344 ATTTGCATGTTATTAAAAGTAGG + Intronic
1047609512 8:126507299-126507321 AATTAAATGTATTTAAAAGTAGG - Intergenic
1047667197 8:127105068-127105090 ACTTTCAGGTGATTAAAAGTGGG + Intergenic
1047942082 8:129836168-129836190 TTTAGCATATAATTAAGAGTGGG - Intergenic
1048200942 8:132373513-132373535 ATATGCAAGTAGTTAAATGTAGG - Intronic
1048468842 8:134689257-134689279 ATTAGCACGTCATTGAAAGTGGG + Intronic
1048812235 8:138299183-138299205 ATTTTAATATAATTAAAATTGGG - Intronic
1048938321 8:139375396-139375418 ATTAGCATGTCATTAAAAGTGGG - Intergenic
1049231138 8:141482527-141482549 AATTGCATGTAATTGGAAGCAGG + Intergenic
1049253512 8:141601889-141601911 ATCTGCATGCAGTTAAAAGTGGG + Intergenic
1049429643 8:142554602-142554624 ATTTGCATACGATTAAAAGTGGG - Intergenic
1049678624 8:143905012-143905034 ATTTGCATGTAAGTAAAAGTGGG + Intergenic
1050788513 9:9435840-9435862 TTTTGCTGGTAATTAAAAATGGG - Intronic
1050991895 9:12166591-12166613 CTTTGCATGTAATCAAAAGTGGG - Intergenic
1050993065 9:12176036-12176058 ATCTGCATGTAATTAAAAGTGGG - Intergenic
1051011155 9:12416204-12416226 ATTTGCATGTAATTGAAAATGGG - Intergenic
1051155607 9:14141370-14141392 ATTGGCATGTTATTACAATTTGG - Intronic
1051948731 9:22604242-22604264 ATGTGCATTTAATTAAAATTGGG - Intergenic
1052131647 9:24855620-24855642 ATTTGCACATAATTTAAAGTGGG + Intergenic
1052135611 9:24906358-24906380 ATTTGCATGTAATTAAGAGTAGG - Intergenic
1052139295 9:24958867-24958889 ATTTACATGCAAGTAAATGTTGG + Intergenic
1052565163 9:30140483-30140505 ATTAGCATATAATTAAGAGTGGG + Intergenic
1052618851 9:30879278-30879300 ATTTACATGGAATTAAAAGAGGG - Intergenic
1052856680 9:33411233-33411255 ATCTGCATACAATTAAAAGTGGG + Intergenic
1053125139 9:35574976-35574998 ATTTGCATGTAGTTAAAAGTGGG + Intergenic
1053572271 9:39321258-39321280 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1053623664 9:39845794-39845816 ATCTACATGTAATTAAAAGTAGG + Intergenic
1053635373 9:39993672-39993694 TTTTGTATGAAATTTAAAGTAGG + Intergenic
1053770558 9:41470628-41470650 TTTTGTATGAAATTTAAAGTAGG - Intergenic
1053881205 9:42597434-42597456 ATCTACATGTAATTAAAAGTAGG - Intergenic
1053891458 9:42696879-42696901 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1054093831 9:60879969-60879991 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1054115307 9:61155893-61155915 ATCTGCATGTAATTAAAAGTAGG + Intergenic
1054124874 9:61297753-61297775 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1054208514 9:62257026-62257048 TTTTGTATGAAATTTAAAGTAGG - Intergenic
1054220234 9:62404905-62404927 ATCTACATGTAATTAAAAGCAGG - Intergenic
1054230481 9:62504267-62504289 ATCTACATGTAATTAAAAGCAGG + Intergenic
1054549289 9:66382463-66382485 TTTTGTATGAAATTTAAAGTAGG - Intergenic
1054592449 9:67026649-67026671 ATCTGCATGTAATTAAAAGTAGG - Intergenic
1054934996 9:70677288-70677310 ATCTACATATAATTAAGAGTTGG + Intronic
1055033794 9:71796636-71796658 ATTTGCATGTAATTTAAAGTGGG + Intronic
1055079488 9:72255199-72255221 ATTTGCATGTAATTGAAAGCAGG - Intronic
1055857617 9:80709796-80709818 ATTTGCACATATTTATAAGTAGG + Intergenic
1056006338 9:82275569-82275591 AGTTGGGTTTAATTAAAAGTCGG - Intergenic
1056305679 9:85288809-85288831 AATTGCATATAATGAAAATTAGG - Intergenic
1056444465 9:86652445-86652467 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1056618658 9:88191417-88191439 TTTTGCATGTAATTAAAAGTGGG - Intergenic
1056918337 9:90763542-90763564 ATTTGCAAGTAATTAAAAGCAGG - Intergenic
1057505626 9:95631246-95631268 ATCTCCAGGTATTTAAAAGTTGG - Intergenic
1057738927 9:97694432-97694454 TTTTGCCTGTTTTTAAAAGTTGG - Intronic
1057746251 9:97754043-97754065 ATCTATATGTATTTAAAAGTAGG - Intergenic
1057783521 9:98069863-98069885 AATTGCATATAATTAAATATAGG + Intronic
1058194593 9:101956918-101956940 ATTAGCATGTCATTAAAAGTGGG + Intergenic
1059420559 9:114188191-114188213 ATTTGCATATAATTAAAGGTGGG - Intronic
1059689310 9:116669244-116669266 ATTTGCATGTAATTAAAAGTGGG + Intronic
1059978389 9:119742703-119742725 ATTTGCATATAATTAAAAGTGGG + Intergenic
1061223196 9:129264448-129264470 ATTTGGAAATAATTAAAAGTGGG - Intergenic
1061224542 9:129273127-129273149 ATTTGCATATAATTAAAAGTGGG + Intergenic
1061305731 9:129732044-129732066 ATTAAAATATAATTAAAAGTAGG + Intergenic
1061853130 9:133427812-133427834 ATTTGCATATAATTAGAAGTGGG - Intronic
1062131232 9:134894494-134894516 ATTTGCATTTAGTTAAAAGTGGG + Intergenic
1185562874 X:1073065-1073087 ATTTGCATGTAATTAGCAGCGGG + Intergenic
1185682369 X:1899094-1899116 ATTTGCATGTAATTAGCAGTGGG - Intergenic
1185803458 X:3034543-3034565 ATCTGCATGCAATTAAAAGTGGG - Intergenic
1185811617 X:3115579-3115601 ATCTGCATGCAATTAAAAATGGG + Intergenic
1185857602 X:3550483-3550505 ATTTGCATGCCATTAGAAGTGGG + Intergenic
1186010415 X:5125439-5125461 ATTTGCATGTTATTAAGAGTGGG + Intergenic
1186045695 X:5534212-5534234 ATCTGCATGTAATTAAAAGTGGG + Intergenic
1186056795 X:5657753-5657775 ATGTGCATGTAAGGAAAATTTGG + Intergenic
1186160651 X:6773830-6773852 ATCTGCAGGAAATTAAAAGTGGG + Intergenic
1186604117 X:11071072-11071094 TTTTGCATATAATTAAAAGTGGG + Intergenic
1187045132 X:15640303-15640325 ATCTACATGTAATTAAAAGTGGG + Intronic
1187096474 X:16153982-16154004 ATTTGAATTTATTTGAAAGTGGG - Intergenic
1188204169 X:27331832-27331854 TTTTGTATGTAATGAAAGGTAGG - Intergenic
1188672633 X:32898561-32898583 ATTTACATGTAATTGAAAGTGGG - Intronic
1188928162 X:36070944-36070966 ATCTGCATGCAATTAAAAATGGG + Intronic
1190251287 X:48728239-48728261 ATTTGCATGTAACTAAAAGGTGG + Intergenic
1190312877 X:49129509-49129531 ATGTTCATGTAATTAACAATAGG - Intergenic
1190554760 X:51623054-51623076 ATTTGCAGGTAATTGAAAGAGGG - Intergenic
1190628405 X:52359956-52359978 ATATACACGTAATTGAAAGTGGG + Intergenic
1190682067 X:52834971-52834993 ATTTACATGGAACTGAAAGTGGG - Intergenic
1190953324 X:55167481-55167503 ATGTACATATAATTGAAAGTGGG + Intronic
1191925471 X:66304829-66304851 ATTTGCATATGATACAAAGTTGG - Intergenic
1192416814 X:70988491-70988513 ATTTGCATGTAACTGAAAGTGGG - Intergenic
1193438282 X:81507463-81507485 ATTTGCAAATAATTCAAAGCAGG + Intergenic
1194067158 X:89275981-89276003 ATTTGCATGTAATTAAAAGTTGG - Intergenic
1194152783 X:90345670-90345692 ATTTGCATGTAATCGTAAGTGGG - Intergenic
1194318027 X:92406153-92406175 ATATGCATATAAATAAATGTTGG - Intronic
1194456857 X:94115446-94115468 ATTTTCATATAACTAACAGTGGG - Intergenic
1194571823 X:95561879-95561901 ATTTGCATATAATTAAATATGGG - Intergenic
1194697639 X:97074572-97074594 ATTTCCATTTAAGAAAAAGTTGG + Intronic
1195092039 X:101469930-101469952 ATTTGCGTATAATTAAAAGTGGG + Intronic
1195095986 X:101501637-101501659 ATTAGCATATAATTATGAGTGGG - Intronic
1195267894 X:103201216-103201238 ATTTGCATGTAACTAAAGGTGGG + Intergenic
1195268841 X:103211368-103211390 ATTTGTGTGTAATTGAAAGTGGG + Intergenic
1195277626 X:103297820-103297842 ATTTGTACATATTTAAAAGTGGG - Intergenic
1195277906 X:103300138-103300160 ATTTGTATATATGTAAAAGTGGG - Intergenic
1195373924 X:104207038-104207060 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1195389215 X:104343662-104343684 ATTTGCATGTAATTGAAAGTGGG - Intergenic
1195447414 X:104970501-104970523 ATTTGCACATAATTAAAAGTGGG - Intronic
1195539975 X:106052594-106052616 ATTTGCATATAATTAAATGTGGG - Intergenic
1195922883 X:110001074-110001096 ATTTGCATATAATGAGCAGTGGG + Intergenic
1195929062 X:110055146-110055168 ATTTGCATGGAATTGAAAACAGG - Intronic
1196260246 X:113570699-113570721 ATTTGCATGGAACCAAAAATGGG - Intergenic
1196768073 X:119267772-119267794 ATTTGCATTTAATTTTATGTAGG + Intergenic
1196947699 X:120844139-120844161 ACTTGTACATAATTAAAAGTCGG - Intergenic
1198175286 X:134148637-134148659 ATCTGCATGCAATTAAAAGTGGG + Intergenic
1198271345 X:135059049-135059071 ATTTGCATGTAATTAAAAGTGGG + Intergenic
1198299318 X:135319341-135319363 TGTTGCATGTAATACAAAGTGGG - Intronic
1198759779 X:140019187-140019209 ATTTGAATATAATTAAAAGTGGG - Intergenic
1198779006 X:140214863-140214885 ATTTGAATATAATTAAAAGTGGG + Intergenic
1198846593 X:140918771-140918793 ATTTGCATATAATTAAAAGTGGG + Intergenic
1199687495 X:150277451-150277473 ATCTGCATGCAACTAAAATTGGG - Intergenic
1200399821 X:156012861-156012883 ATTTGTATATAGTTACAAGTGGG + Intergenic
1200499127 Y:3922415-3922437 ATTTGCATGTAATCGTAAGTGGG - Intergenic
1200626203 Y:5519443-5519465 ATATGCATATAAATAAATGTTGG - Intronic
1200721319 Y:6610190-6610212 ATTTGCATGTAATTAAAAGTTGG - Intergenic
1201139350 Y:11015417-11015439 AATGCCATGTAATTGAAAGTTGG - Intergenic
1201269681 Y:12242730-12242752 ATCTGCATGCAATTAAAAATGGG - Intergenic
1201277280 Y:12311109-12311131 ATCTACACGCAATTAAAAGTCGG + Intergenic
1201343934 Y:12961836-12961858 ATCTACACGTAACTAAAAGTGGG + Intergenic
1201501781 Y:14651287-14651309 AATTGTATTTATTTAAAAGTTGG + Intronic