ID: 1123849961

View in Genome Browser
Species Human (GRCh38)
Location 15:24344332-24344354
Sequence GGGGCAGTCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123849957_1123849961 2 Left 1123849957 15:24344307-24344329 CCACTTTTAATTACATGCAAATT 0: 61
1: 176
2: 260
3: 217
4: 542
Right 1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG No data
1123849956_1123849961 3 Left 1123849956 15:24344306-24344328 CCCACTTTTAATTACATGCAAAT 0: 70
1: 178
2: 280
3: 215
4: 507
Right 1123849961 15:24344332-24344354 GGGGCAGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123849961 Original CRISPR GGGGCAGTCAATGCAAATTG AGG Intergenic
No off target data available for this crispr