ID: 1123853023

View in Genome Browser
Species Human (GRCh38)
Location 15:24379895-24379917
Sequence CCACACTAGCAGCCAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123853023_1123853029 12 Left 1123853023 15:24379895-24379917 CCTTAGCCTGGCTGCTAGTGTGG No data
Right 1123853029 15:24379930-24379952 TTGTGTTTTTGGTTGCGTAGAGG No data
1123853023_1123853028 1 Left 1123853023 15:24379895-24379917 CCTTAGCCTGGCTGCTAGTGTGG No data
Right 1123853028 15:24379919-24379941 GTGTGTTGCTCTTGTGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123853023 Original CRISPR CCACACTAGCAGCCAGGCTA AGG (reversed) Intergenic
No off target data available for this crispr