ID: 1123853029

View in Genome Browser
Species Human (GRCh38)
Location 15:24379930-24379952
Sequence TTGTGTTTTTGGTTGCGTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123853023_1123853029 12 Left 1123853023 15:24379895-24379917 CCTTAGCCTGGCTGCTAGTGTGG No data
Right 1123853029 15:24379930-24379952 TTGTGTTTTTGGTTGCGTAGAGG No data
1123853021_1123853029 17 Left 1123853021 15:24379890-24379912 CCATCCCTTAGCCTGGCTGCTAG No data
Right 1123853029 15:24379930-24379952 TTGTGTTTTTGGTTGCGTAGAGG No data
1123853027_1123853029 6 Left 1123853027 15:24379901-24379923 CCTGGCTGCTAGTGTGGGGTGTG No data
Right 1123853029 15:24379930-24379952 TTGTGTTTTTGGTTGCGTAGAGG No data
1123853022_1123853029 13 Left 1123853022 15:24379894-24379916 CCCTTAGCCTGGCTGCTAGTGTG No data
Right 1123853029 15:24379930-24379952 TTGTGTTTTTGGTTGCGTAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123853029 Original CRISPR TTGTGTTTTTGGTTGCGTAG AGG Intergenic
No off target data available for this crispr