ID: 1123853363

View in Genome Browser
Species Human (GRCh38)
Location 15:24382654-24382676
Sequence GCTACTGTGACCTGGGCGGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123853363_1123853373 29 Left 1123853363 15:24382654-24382676 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853363_1123853372 28 Left 1123853363 15:24382654-24382676 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123853372 15:24382705-24382727 TGTGTATTTCTTGTTTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123853363 Original CRISPR GCTACTGTGACCTGGGCGGC GGG (reversed) Intergenic
No off target data available for this crispr