ID: 1123853373

View in Genome Browser
Species Human (GRCh38)
Location 15:24382706-24382728
Sequence GTGTATTTCTTGTTTTTCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123853371_1123853373 -8 Left 1123853371 15:24382691-24382713 CCATGTGCACTCACTGTGTATTT No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853366_1123853373 22 Left 1123853366 15:24382661-24382683 CCCAGGTCACAGTAGCCCCTTCT No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853368_1123853373 7 Left 1123853368 15:24382676-24382698 CCCCTTCTATTTTTTCCATGTGC No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853362_1123853373 30 Left 1123853362 15:24382653-24382675 CCCCGCCGCCCAGGTCACAGTAG No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853364_1123853373 28 Left 1123853364 15:24382655-24382677 CCGCCGCCCAGGTCACAGTAGCC No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853370_1123853373 5 Left 1123853370 15:24382678-24382700 CCTTCTATTTTTTCCATGTGCAC No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853363_1123853373 29 Left 1123853363 15:24382654-24382676 CCCGCCGCCCAGGTCACAGTAGC No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853365_1123853373 25 Left 1123853365 15:24382658-24382680 CCGCCCAGGTCACAGTAGCCCCT No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853367_1123853373 21 Left 1123853367 15:24382662-24382684 CCAGGTCACAGTAGCCCCTTCTA No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data
1123853369_1123853373 6 Left 1123853369 15:24382677-24382699 CCCTTCTATTTTTTCCATGTGCA No data
Right 1123853373 15:24382706-24382728 GTGTATTTCTTGTTTTTCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123853373 Original CRISPR GTGTATTTCTTGTTTTTCCT GGG Intergenic