ID: 1123854901

View in Genome Browser
Species Human (GRCh38)
Location 15:24398888-24398910
Sequence GGGCAGGTCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123854895_1123854901 4 Left 1123854895 15:24398861-24398883 CCCACTTTTAATTATACACAAAT No data
Right 1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG No data
1123854896_1123854901 3 Left 1123854896 15:24398862-24398884 CCACTTTTAATTATACACAAATT No data
Right 1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG No data
1123854894_1123854901 5 Left 1123854894 15:24398860-24398882 CCCCACTTTTAATTATACACAAA No data
Right 1123854901 15:24398888-24398910 GGGCAGGTCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123854901 Original CRISPR GGGCAGGTCAATGCAAATTG AGG Intergenic
No off target data available for this crispr