ID: 1123861159

View in Genome Browser
Species Human (GRCh38)
Location 15:24468067-24468089
Sequence CACAATGCTGATAGTGACAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123861159_1123861162 3 Left 1123861159 15:24468067-24468089 CCCATGTCACTATCAGCATTGTG No data
Right 1123861162 15:24468093-24468115 ACAACAATTTAACCAGTCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123861159 Original CRISPR CACAATGCTGATAGTGACAT GGG (reversed) Intergenic