ID: 1123868981

View in Genome Browser
Species Human (GRCh38)
Location 15:24552463-24552485
Sequence CCACACTAGCAGCCAGGCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123868981_1123868987 12 Left 1123868981 15:24552463-24552485 CCTTAGCCTGGCTGCTAGTGTGG No data
Right 1123868987 15:24552498-24552520 TTGTGTTTTTGGATGTGTAGAGG No data
1123868981_1123868986 1 Left 1123868981 15:24552463-24552485 CCTTAGCCTGGCTGCTAGTGTGG No data
Right 1123868986 15:24552487-24552509 GTGTGTTGCTCTTGTGTTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123868981 Original CRISPR CCACACTAGCAGCCAGGCTA AGG (reversed) Intergenic
No off target data available for this crispr