ID: 1123870927

View in Genome Browser
Species Human (GRCh38)
Location 15:24571846-24571868
Sequence AATTTGCATATAATTAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1422
Summary {0: 59, 1: 175, 2: 188, 3: 281, 4: 719}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123870927_1123870932 7 Left 1123870927 15:24571846-24571868 CCACTTTTAATTATATGCAAATT 0: 59
1: 175
2: 188
3: 281
4: 719
Right 1123870932 15:24571876-24571898 AGATCAATGCAAATTGAGGCAGG No data
1123870927_1123870934 13 Left 1123870927 15:24571846-24571868 CCACTTTTAATTATATGCAAATT 0: 59
1: 175
2: 188
3: 281
4: 719
Right 1123870934 15:24571882-24571904 ATGCAAATTGAGGCAGGAAAGGG No data
1123870927_1123870936 28 Left 1123870927 15:24571846-24571868 CCACTTTTAATTATATGCAAATT 0: 59
1: 175
2: 188
3: 281
4: 719
Right 1123870936 15:24571897-24571919 GGAAAGGGGCAGTGACTTCTAGG No data
1123870927_1123870931 3 Left 1123870927 15:24571846-24571868 CCACTTTTAATTATATGCAAATT 0: 59
1: 175
2: 188
3: 281
4: 719
Right 1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG No data
1123870927_1123870933 12 Left 1123870927 15:24571846-24571868 CCACTTTTAATTATATGCAAATT 0: 59
1: 175
2: 188
3: 281
4: 719
Right 1123870933 15:24571881-24571903 AATGCAAATTGAGGCAGGAAAGG No data
1123870927_1123870935 14 Left 1123870927 15:24571846-24571868 CCACTTTTAATTATATGCAAATT 0: 59
1: 175
2: 188
3: 281
4: 719
Right 1123870935 15:24571883-24571905 TGCAAATTGAGGCAGGAAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123870927 Original CRISPR AATTTGCATATAATTAAAAG TGG (reversed) Intergenic
900737098 1:4305817-4305839 AATTTGCATGTAACTAACAGTGG - Intergenic
901779194 1:11581758-11581780 AATCTGCATATAATTAGATGTGG + Intergenic
902153398 1:14463079-14463101 AATTTGCATGTAATTAAAAGTGG - Intergenic
902155844 1:14485586-14485608 AATCTGCACGCAATTAAAAGTGG + Intergenic
902259942 1:15217346-15217368 CTTTTGCACATAATTGAAAGTGG + Intronic
902260123 1:15218860-15218882 AATTTGCATGTGACTAAAAGTGG + Intronic
902714078 1:18260556-18260578 AATTTGCATGTAATTGAAAGTGG - Intronic
902714246 1:18261550-18261572 AATTTGCATGTAATTAAAAGTGG + Intronic
902749067 1:18494083-18494105 AATTTGCATGTAATTAAAAGTGG - Intergenic
902959903 1:19955893-19955915 AATTAGCATGTCATTCAAAGTGG + Intergenic
902966517 1:20008520-20008542 AATTTACATGTGGTTAAAAGTGG - Intergenic
903794841 1:25920863-25920885 AATTTGCATGTAATTAAAAGTGG + Intergenic
903824413 1:26132784-26132806 AATTTGCATATAATTAAAAGTGG + Intergenic
903923369 1:26817134-26817156 AATTTGCATAAAATAATAAAAGG - Intergenic
904060469 1:27705980-27706002 AAGTTGAATATACTTAAAAGAGG - Intergenic
904347651 1:29883739-29883761 AATCTGCATGCAGTTAAAAGTGG + Intergenic
904348554 1:29890110-29890132 AATCTGCATGTCATTAAAAGTGG + Intergenic
904407839 1:30305041-30305063 AATTTGCATGTAATTAAAAGTGG + Intergenic
904455987 1:30648439-30648461 AATTTGCATATAATTAAAATTGG - Intergenic
904718355 1:32486508-32486530 AATTTGCATGTAACTAAAAGTGG - Exonic
905459962 1:38116066-38116088 AATTTGCATATTTGTAAATGAGG - Intergenic
906182401 1:43833562-43833584 AATTTGCACATCTTTAAAAGTGG - Intronic
906217285 1:44050483-44050505 AATTTGCATGTACTTAAAAGTGG + Intergenic
906218876 1:44061608-44061630 AATTTGCATGTAATTAAAAATGG + Intergenic
906234417 1:44195896-44195918 AATTTGCATGTAATCGAAAGTGG + Intergenic
906499876 1:46333846-46333868 AATTTGCATCTAATTAAAAGTGG + Intergenic
906578280 1:46910860-46910882 AATCTGCATGCAATTAAAAGTGG - Intergenic
906870184 1:49470754-49470776 AATTTGCATACAATTGAAGTGGG + Intronic
907002295 1:50873687-50873709 AATTTGCATGTAATTAAAAGTGG + Intronic
907026415 1:51124609-51124631 AATTTGCATGTAATTGAATGTGG - Intronic
907510913 1:54958156-54958178 AATTGGCTTATAAGTAAAAGAGG + Intergenic
907555142 1:55336852-55336874 TATGTGCATATTATTAATAGGGG + Intergenic
907652645 1:56310458-56310480 AATCTGCATGCAATTAAAAGTGG - Intergenic
907695096 1:56717467-56717489 AATTTCCTTATTATTAAAACAGG - Intergenic
907910263 1:58819659-58819681 AATTTGAAACTCATTAAAAGAGG - Intergenic
908297543 1:62728099-62728121 AATCTGCATACAATTAAAAGTGG - Intergenic
908502174 1:64754662-64754684 AATTTGCATATTATTTCAAGGGG + Intronic
908515308 1:64886229-64886251 GATTTGCATATTTTTAAAAAAGG - Intronic
908724326 1:67158473-67158495 AATTTGTATATGATTAAAATTGG - Intronic
909007202 1:70290860-70290882 AATTTGTATCTAAATAAAAATGG - Intronic
909375608 1:74938173-74938195 AATTTAAACATAATTTAAAGTGG - Intergenic
909462331 1:75931701-75931723 AATTTACATATAAATAAAAATGG + Intronic
909464707 1:75960405-75960427 TATTTGGATAAAATTAAAATTGG - Intergenic
909516125 1:76509231-76509253 AATTGGAAGATAAATAAAAGGGG + Intronic
910354311 1:86338285-86338307 AATTTACATTTAAATAAAAAGGG - Intergenic
910479048 1:87638598-87638620 AATTTGCATATACTTAAAAATGG + Intergenic
911216112 1:95197362-95197384 AACTTGCATATACTTTAAAATGG - Exonic
911229331 1:95344193-95344215 AATTCTCCTATAATTAAAATTGG - Intergenic
911409803 1:97488841-97488863 AATTTGGATGTAATCAAAAGTGG + Intronic
911732330 1:101304162-101304184 CATTTGCATGTAATTAAAAGTGG + Intergenic
911866763 1:103036251-103036273 AATTTGTATATAATTAAGTATGG - Intronic
911882418 1:103257457-103257479 AATTTGCCTATAATAAGAACTGG - Intergenic
911937955 1:104004714-104004736 GATTTGCATATAATTAAAAGTGG + Intergenic
911986168 1:104626601-104626623 AAACTGTATATAATTAAAATGGG - Intergenic
912045067 1:105443689-105443711 AATTGGCATATAATTACATTTGG - Intergenic
912069970 1:105796811-105796833 AATTTGCATGTGATTAAAAATGG - Intergenic
912135020 1:106650360-106650382 GATTTGCAAATATCTAAAAGTGG - Intergenic
912617523 1:111119511-111119533 AATTTCCAGATAACAAAAAGTGG + Intronic
912824978 1:112897383-112897405 AATTTGAATAAAAATATAAGTGG - Intergenic
912864749 1:113247285-113247307 AATTTGCATTCAATTATAGGGGG + Intergenic
912971402 1:114287047-114287069 ACTTTGCATATAATTGAAAGTGG - Intergenic
913232198 1:116749387-116749409 AATTTGCATATAATTAAAATGGG - Intergenic
913324947 1:117619794-117619816 ATTTAGTATATAATTAAAGGAGG - Intronic
913373085 1:118122264-118122286 AATTTGCAAATGATTGAAAAGGG + Intronic
913658185 1:120981807-120981829 AATTGGCATGTAATTAAAAGTGG - Intergenic
913964504 1:143364368-143364390 AATTTGCATATAAAAAAGACTGG - Intergenic
914009541 1:143764876-143764898 AATTGGCATGTAATTAAAAGTGG - Intergenic
914058873 1:144189974-144189996 AATTTGCATATAAAAAAGACTGG - Intergenic
914120276 1:144776397-144776419 AATTTGCATATAAAAAAGACTGG + Intergenic
914408006 1:147396043-147396065 AATTTGCATATAATTAAAAGTGG - Intergenic
914503872 1:148271697-148271719 AATATACATACAATTAAAAAAGG + Intergenic
914522753 1:148433072-148433094 AATTGGCATGCAATTAAAAGTGG - Intergenic
914648166 1:149673551-149673573 AATTGGCATGTAATTAAAAGTGG - Intergenic
914938367 1:152000575-152000597 AATCTGCATGCAATTAAAAGTGG - Intergenic
914982361 1:152425944-152425966 AATTAGCATGTCATTAAAAGTGG + Intergenic
915259314 1:154664947-154664969 AATTTGCATGTAATTAAAAGTGG + Intergenic
915262599 1:154688461-154688483 AATTTACATAAAAACAAAAGAGG - Intergenic
915427577 1:155839775-155839797 AAGTTAGCTATAATTAAAAGTGG + Intronic
915653260 1:157335246-157335268 AAGTTCCATATAATAAAAAAAGG - Intergenic
916005801 1:160658940-160658962 AATTTGCATATAATTAGAAGTGG - Intergenic
916793105 1:168141408-168141430 TATTTGCTTATACTTAAAAGTGG + Intergenic
916829639 1:168477294-168477316 AATTAGCATATCATTAAAAAGGG + Intergenic
917072264 1:171165177-171165199 AATTAGCATATTTTTAAAAAAGG + Intergenic
917154794 1:171984729-171984751 AATTGGGATATAATTAAGGGGGG - Intronic
917205495 1:172566657-172566679 AATTTGCATATAATTAAAAGTGG - Intronic
917237552 1:172910672-172910694 AATTAGCATAAAATAAAAAGTGG - Intergenic
917382076 1:174422558-174422580 TATTTGCATATCAATAAAAGGGG - Intronic
917613932 1:176717446-176717468 AATTAGCATATAATTAAAAGTGG + Intronic
918420657 1:184361322-184361344 AATTTGCATGTAATTAAAAGTGG - Intergenic
918675276 1:187276777-187276799 TATTTGAATAAAATTAAAACTGG + Intergenic
918682437 1:187372085-187372107 AATTTGCATGTAATTGAAAGTGG + Intergenic
918682498 1:187372731-187372753 AATTTGCATGTAGTTGAAAATGG - Intergenic
918794306 1:188873261-188873283 AACTTGCATGTCATTAAAAGTGG + Intergenic
919139710 1:193555772-193555794 ACTTTGCATATTATTAAAAGTGG + Intergenic
920063420 1:203245847-203245869 AATTTGCATATAATTATAAGTGG - Intronic
921073863 1:211684362-211684384 AATCTGCATGCAGTTAAAAGTGG - Intergenic
921114554 1:212076294-212076316 ACTTTACATAGCATTAAAAGTGG - Intronic
921271552 1:213474740-213474762 AATTTGGATCTAATAAAATGAGG + Intergenic
921387251 1:214582568-214582590 AGTTTGCATGTAAATTAAAGTGG - Intergenic
921503456 1:215936094-215936116 AATGTACATATAATAAAAAGTGG - Intronic
921634308 1:217474933-217474955 AAAATGCATATAAATAAAAAAGG + Intronic
921802403 1:219416589-219416611 AATTTGCATACAATTAAAAGTGG - Intergenic
921807193 1:219469337-219469359 AAATTGCAAATAATTAAATTGGG + Intergenic
922459959 1:225808432-225808454 AATCTGCATGTAACTAAAAGTGG - Intergenic
922538499 1:226401409-226401431 AATTTGCATATAATTAAAAGTGG - Intronic
922711058 1:227833185-227833207 AATTTATATGTAATTAGAAGAGG + Intronic
923202464 1:231725518-231725540 AATTTGCCTGTAATTGAAAGTGG + Intronic
923350838 1:233104374-233104396 ATTTTGCTTACTATTAAAAGAGG - Intronic
923459516 1:234196279-234196301 AATTTGCATGTAATTAAAAGTGG + Intronic
924279005 1:242417471-242417493 AGTTTGCATGTAATTAAAAGTGG + Intronic
924463323 1:244278872-244278894 AATTTAAATATAAAGAAAAGAGG - Intergenic
924844566 1:247752546-247752568 AATTTGCATAGAATCACAAAAGG - Intergenic
924848179 1:247794266-247794288 AATTTGCATGTAATTGGAAGTGG + Intergenic
1062863667 10:830903-830925 AATTTGCATATAATGATAATTGG - Exonic
1063493511 10:6486498-6486520 AATTTGCATGTAGTTAAAAGTGG + Intronic
1063533847 10:6863415-6863437 AATTTGCATGTATGTAATAGTGG - Intergenic
1063560796 10:7125146-7125168 TATTTGCATATAAATACAGGTGG - Intergenic
1063925776 10:10975920-10975942 AATTTGCATGTAATTGAAAGTGG - Intergenic
1063965930 10:11345800-11345822 AATTTGCATGTGATTGAAAGTGG - Intergenic
1063966822 10:11352487-11352509 AATTTGCATGTAATTGAAAGTGG - Intergenic
1064233972 10:13556205-13556227 AATTTGTGTATAGTTAAAACAGG - Intergenic
1064383935 10:14874217-14874239 AATATGTATATATTTAAATGTGG + Intergenic
1064415204 10:15143426-15143448 AATTTGGAGATATTTTAAAGTGG - Intronic
1064461720 10:15541040-15541062 AAGTTGCATATAATTGAACATGG + Intronic
1064647356 10:17473107-17473129 AATTTGCATGTAACTGAAAGTGG + Intergenic
1064689137 10:17895915-17895937 CATTTGCATGTAATTAAAAGTGG - Intronic
1064862761 10:19845742-19845764 GATTTGCATGTAATTAAAAGTGG - Intronic
1064887663 10:20129031-20129053 GATTTCCACAAAATTAAAAGTGG - Intronic
1065369281 10:24966789-24966811 AATTTCCCTATCAGTAAAAGAGG + Intergenic
1065463734 10:25996974-25996996 AATTTTTATATAATTCAAAGTGG + Intronic
1065517824 10:26542790-26542812 TATCTGTAAATAATTAAAAGTGG - Intronic
1066119614 10:32272250-32272272 AGTTTGAATATAAGTAAAAATGG + Intronic
1066201577 10:33146913-33146935 AATTTGCATTTAATTGTAATCGG + Intergenic
1066312056 10:34206666-34206688 AATTTGCATGTAGTTAAAAGTGG - Intronic
1066367691 10:34792843-34792865 TAGTTGTAAATAATTAAAAGTGG - Intronic
1066992842 10:42532295-42532317 AATTTGCAAATAATAAGAAAGGG + Intergenic
1067996970 10:51284461-51284483 GATTTGCAAATTATTAAAATAGG + Intronic
1068086475 10:52379730-52379752 AATATGCATGTAACTGAAAGTGG - Intergenic
1068378612 10:56216960-56216982 AATTTGCATATAATTAAAAGTGG + Intergenic
1068657267 10:59588559-59588581 AATTTGTGTGTAATTGAAAGTGG - Intergenic
1068691505 10:59920446-59920468 AATTTGCATATAATTAAAAGTGG - Intergenic
1068724193 10:60282545-60282567 AATTTGCACATAATTTCATGTGG + Intronic
1069048181 10:63764874-63764896 AATCTGCATGCAATTAAAAGTGG - Intergenic
1069265783 10:66455627-66455649 AACATGCATGTAATTAAAAGTGG + Intronic
1070075002 10:73126396-73126418 AATTTGCAAATGGTGAAAAGTGG + Intronic
1070184886 10:74052005-74052027 AATTAGAATATAATTAAAAGTGG - Intronic
1070196300 10:74160331-74160353 AATTTGTATATAATTAAAATTGG + Intronic
1070205323 10:74253280-74253302 AATCTGCATGTTATTAAAAAAGG - Intronic
1070760253 10:79019794-79019816 AGTTTGGCTAGAATTAAAAGGGG - Intergenic
1071166971 10:82818098-82818120 AATCTGCATACAATTAATAGTGG - Intronic
1071223968 10:83504662-83504684 AACATGAATATAATTAAAAATGG + Intergenic
1071436115 10:85649459-85649481 AATTTGCCTGTAATGAAAGGAGG + Intronic
1071675416 10:87651252-87651274 AATTAGCATATAATGAGCAGAGG - Intergenic
1071946551 10:90652292-90652314 AATTTGCATATAATTAAAAGTGG + Intergenic
1072264287 10:93712696-93712718 AATTTGCATGTAATTAAAAGTGG + Intergenic
1072397226 10:95057033-95057055 AATATGCATGCAATTAAAAGTGG - Intronic
1072417073 10:95257785-95257807 CTTTTGTATATAATCAAAAGTGG - Intronic
1072526854 10:96279435-96279457 AATTTGCATCTAATTAAAAGTGG + Intergenic
1072875655 10:99170292-99170314 TATTTGCATACATTTAGAAGTGG - Intronic
1072887881 10:99296463-99296485 AATCTACATGCAATTAAAAGTGG + Intergenic
1072888953 10:99304331-99304353 AATCTGCATGCAATTAAAAGTGG + Intergenic
1073127229 10:101158917-101158939 AATTTGCATATAGTTAAAAGCGG + Intergenic
1073793324 10:106961796-106961818 AATTTGCAAGTTATTAAAAGTGG + Intronic
1073879847 10:107968063-107968085 AATTTGAATATAAGTTAGAGGGG - Intergenic
1073893392 10:108125273-108125295 AATTCACATATAATTAAAAGTGG - Intergenic
1073936116 10:108634380-108634402 AATTAGCATGTTATTAAAAGTGG - Intergenic
1074390759 10:113056363-113056385 AATTTGAATCTAATTGGAAGTGG + Intronic
1074504012 10:114051323-114051345 AATTTGCAAATAGTTGAAGGTGG - Intergenic
1074684926 10:115952446-115952468 AATTTGCATTTAATTTTTAGTGG - Intergenic
1074739490 10:116471076-116471098 TATTTGAAAATAATTGAAAGGGG - Intronic
1075294225 10:121259470-121259492 AATTTACATGTAATTAAAAATGG - Intergenic
1075363632 10:121862924-121862946 AATTTGCATGCAATTAAAGGGGG + Intronic
1075598764 10:123751677-123751699 ATTTTGCATAAAATAAACAGGGG - Intronic
1075641615 10:124068868-124068890 AATTTTCAAACAATAAAAAGGGG + Intronic
1076083910 10:127608096-127608118 AATTAGCATGTAATTAAAAATGG - Intergenic
1076210558 10:128640483-128640505 AATGTGCAAAAAATTTAAAGAGG + Intergenic
1076824988 10:132962425-132962447 AATCTGCATGCGATTAAAAGCGG + Intergenic
1077039520 11:513005-513027 AATCTACATGAAATTAAAAGTGG + Intergenic
1077502108 11:2914051-2914073 CATTTGCATATAAGGAAATGAGG + Intronic
1077558835 11:3243010-3243032 AACTCACATGTAATTAAAAGTGG + Intergenic
1077983106 11:7321736-7321758 AATTTGTATGTAATTGGAAGTGG - Intronic
1078281594 11:9907599-9907621 ATTGTGCATATAAATAACAGTGG - Intronic
1078409877 11:11105657-11105679 AATCTGTATGCAATTAAAAGTGG + Intergenic
1078489084 11:11752708-11752730 AATTAGCATATAATTTAGATTGG - Intergenic
1078499503 11:11856338-11856360 AATTTGCATACAAATCAAAGTGG + Intronic
1078616833 11:12873674-12873696 AATTTGCTTATCATTAGAAAAGG - Intronic
1078982569 11:16553341-16553363 AATTTGCATATAATTGAAAGTGG - Intronic
1079064021 11:17274246-17274268 AATTTGCATATACTTAAAAGTGG + Intronic
1079164766 11:18029392-18029414 AATTAGCATTTAATAAATAGTGG + Intronic
1079177075 11:18152367-18152389 AATTTGTGTATCACTAAAAGTGG - Intronic
1079499731 11:21089667-21089689 AAGTTTTATAGAATTAAAAGAGG + Intronic
1079741474 11:24067315-24067337 GATGTGAATATAATTAAAAATGG - Intergenic
1080382590 11:31789436-31789458 CCTTTGCATATAATTAAACCTGG - Exonic
1080650288 11:34217038-34217060 AATTTGCATATAATTAAAAGTGG + Intronic
1080873148 11:36254408-36254430 TATTTGCATACAATTTCAAGGGG + Intergenic
1080963229 11:37184650-37184672 GGTTTGCATATACTTTAAAGGGG + Intergenic
1081004539 11:37718639-37718661 AATTAGCATGTAATTAAAGTTGG - Intergenic
1081155507 11:39684717-39684739 AATTTTTATATATTTAAAAATGG + Intergenic
1081324698 11:41729916-41729938 TATTTGCAAAAAGTTAAAAGAGG - Intergenic
1081842714 11:46214901-46214923 AATTTGTATATAATTAAAAGTGG + Intergenic
1082154502 11:48789294-48789316 AATTTGCACATACTTCAAAAAGG + Intergenic
1082224260 11:49683781-49683803 ATTTTGCATATAAAGAAATGAGG - Intergenic
1082662966 11:55936791-55936813 AATATGTATATTATTAAAAATGG + Intergenic
1082827870 11:57594012-57594034 AATCTGCATGTAATGGAAAGTGG + Intergenic
1082898515 11:58219556-58219578 AATTAGCATTAAATTGAAAGTGG + Intergenic
1082921251 11:58496881-58496903 AATTATCATAGAATTAAGAGTGG + Intergenic
1083361970 11:62115396-62115418 AATTTGCATATAAACAAAAGTGG + Intergenic
1083543488 11:63531439-63531461 AATTAGCATATAATTAAAAGTGG - Intergenic
1083700338 11:64473251-64473273 AATTTGCATGCAATTGAAATTGG + Intergenic
1083817806 11:65146802-65146824 AATTTGCATATAATTAAAAGTGG - Intergenic
1083908222 11:65688138-65688160 AATTTGCATATAATTAAAAGTGG + Intergenic
1083914382 11:65730655-65730677 AATTAGCATACCATTAAGAGTGG + Intergenic
1083982421 11:66183805-66183827 AATTTGCATGTAATTAAGAGTGG - Intronic
1084186154 11:67472955-67472977 AATTTGCATGTAATTAAAAGTGG - Intergenic
1084240796 11:67818350-67818372 AATCTGCATGCAATTAAAAGTGG - Intergenic
1084406229 11:68975232-68975254 AACTTGCATATAATTGAAAGTGG + Intergenic
1084697767 11:70766103-70766125 AATGTGCATGTCCTTAAAAGAGG + Intronic
1084731831 11:71078790-71078812 AATTTGCATGTAATTAAAAGTGG + Intronic
1084831643 11:71774362-71774384 AATCTGCATGTAATTAAAAGTGG + Intergenic
1085631566 11:78121939-78121961 AATTTTCATAAAATAAAAATAGG - Intronic
1085825011 11:79837678-79837700 AATTAGAATATACTTAAAAATGG + Intergenic
1086069799 11:82788061-82788083 AATTTGCATGAAAATAGAAGCGG - Intergenic
1086080414 11:82898275-82898297 ACTTTGCATATCATCAAAAATGG + Intronic
1086427631 11:86702440-86702462 AATTTGCATGTAGTTAAAAGTGG - Intergenic
1086554421 11:88091900-88091922 CATTTGCATGTAATTGAAAGTGG - Intergenic
1086624785 11:88935413-88935435 ATTTTGCATATAAGGAAATGAGG + Intronic
1086684267 11:89712932-89712954 AATTTGCACGTATTTAAAGGTGG + Intronic
1087285186 11:96257647-96257669 AATATGCACATGATAAAAAGGGG - Intronic
1087444639 11:98234771-98234793 AATCTGCATGCAATTAAAAGTGG - Intergenic
1087750658 11:102003373-102003395 AAATTAAATATAAATAAAAGTGG + Intergenic
1088065159 11:105708747-105708769 AAGTTGCAAATAAAAAAAAGAGG + Intronic
1088108574 11:106233745-106233767 AATTTCCAAATCATTAAAAAAGG - Intergenic
1088181469 11:107117430-107117452 AATTTGCATGTAATTAAAAGTGG - Intergenic
1088380190 11:109184342-109184364 AATTTACATGTAATTGAAAGTGG - Intergenic
1088833269 11:113556270-113556292 ACTTTGCATATAAGGAAATGGGG - Intergenic
1089161634 11:116442419-116442441 CATTAACATATAATTAAGAGTGG - Intergenic
1089656512 11:119950856-119950878 AAATTGCATCTGATTAAAACAGG - Intergenic
1089913586 11:122128562-122128584 AATTTGCAGATATTGAAAATGGG + Intergenic
1090034837 11:123239904-123239926 AATTTGCAGGATATTAAAAGCGG - Intergenic
1090302836 11:125661129-125661151 ATTTTTAAGATAATTAAAAGAGG - Intronic
1090313316 11:125762728-125762750 AATCTGTATAAAATAAAAAGTGG + Intergenic
1090458883 11:126872320-126872342 AATTTGCATGTAAATAAAGGGGG + Intronic
1090712426 11:129399723-129399745 AATTTACATATAATTAAAAGGGG - Intronic
1090713838 11:129412574-129412596 AATTTGCATATAATTAAAAGTGG - Intronic
1091467093 12:694249-694271 AATTTGCATATAATTAAAAGTGG + Intergenic
1091869398 12:3874928-3874950 AATAAGCAGATAATTAATAGAGG - Intergenic
1092135122 12:6141984-6142006 AACTTGCAAGTAATTGAAAGTGG - Intergenic
1092520672 12:9269511-9269533 AATTTCCATGTAACTAAAATGGG + Intergenic
1092642020 12:10523076-10523098 ATTTTTCATATAATTAAATTAGG - Intronic
1092721808 12:11448616-11448638 AATTTGCATAGAAATCAAATGGG + Intronic
1093206352 12:16255888-16255910 TATTTGCATTTATTTAAAAATGG + Intronic
1093227545 12:16503826-16503848 AATTTGCATTTAATTAAAAGTGG + Intronic
1093380026 12:18480743-18480765 AATTTGCGTATAATTAAAGGTGG + Intronic
1093627822 12:21371078-21371100 AATCTGCATGTAGTTAAAAGTGG - Intronic
1093869785 12:24275620-24275642 AATTTTCATATATTTATAAGTGG - Intergenic
1094061422 12:26318641-26318663 AGTTTCCAAATAATTAAAAGAGG - Intergenic
1094445585 12:30526292-30526314 AATTTGCATTTAATTAATCATGG + Intergenic
1094475955 12:30840718-30840740 AACTTGCATATTATTAAAAGTGG - Intergenic
1094581441 12:31737422-31737444 GATTTGCATGTAATTAGAAGTGG - Intergenic
1094709794 12:32950096-32950118 AATCTGCATACAATTAAAAGTGG + Intergenic
1094762289 12:33547955-33547977 AATTTGCTTATAATAATAACAGG + Intergenic
1095278257 12:40317058-40317080 AATCTGCATTTTTTTAAAAGGGG - Intronic
1095375004 12:41516280-41516302 GATGTGCAGATAATTACAAGTGG - Intronic
1095480304 12:42627916-42627938 AATTTACATTTAAATAAAAAGGG + Intergenic
1096953499 12:55501105-55501127 AGTTTGCATAAAATTAAAATAGG - Intergenic
1097463756 12:59896894-59896916 TATTAGCATATAATTAAAATTGG - Intergenic
1097571547 12:61339505-61339527 AATTTACATATAATCTAAAATGG - Intergenic
1097604861 12:61741213-61741235 AATTTGCATATAAAAAATTGGGG - Intronic
1097878470 12:64665689-64665711 AATTTGCATGTAATTAAAAATGG + Intronic
1098898909 12:76092649-76092671 AATTTACATATAATTAAAAGTGG + Intergenic
1099001224 12:77180079-77180101 AATTTGCACCTACGTAAAAGGGG - Intergenic
1099307135 12:80971487-80971509 AATTTGCATATAGTCTAAGGTGG - Intronic
1099416293 12:82390971-82390993 AATTTAGTTAGAATTAAAAGGGG + Intronic
1099529689 12:83762737-83762759 AATCTGCATGCAATTAAAAGTGG + Intergenic
1099562491 12:84195392-84195414 TATTTGCATGTAACTGAAAGTGG + Intergenic
1099674804 12:85745059-85745081 AATTCTAAAATAATTAAAAGAGG + Intergenic
1099785610 12:87258719-87258741 AATGCACATATCATTAAAAGTGG - Intergenic
1099869758 12:88332080-88332102 AGTTTGCATATAATTAAAAGTGG - Intergenic
1100010132 12:89942934-89942956 AATTTGCATAGAATTAAAAGTGG - Intergenic
1100548959 12:95628792-95628814 AATTTGCATATAATTAAAAGTGG + Intergenic
1100806012 12:98284338-98284360 TAGTTGCTTATAATTCAAAGAGG + Intergenic
1100817254 12:98398157-98398179 AATTAGCATAAAATGAACAGGGG + Intergenic
1101147077 12:101851300-101851322 AATTTGCAAGTAATTAAAGGTGG - Intergenic
1101354299 12:103962699-103962721 GATTTGCATATAATTAGAAGTGG + Intronic
1101397537 12:104361665-104361687 AATTTGCATGTAATAAAAAGTGG + Intergenic
1101480509 12:105092247-105092269 AATTTTCCTTTAATAAAAAGCGG + Intergenic
1101530464 12:105568773-105568795 AACTTGCATATAATTAAAAGTGG - Intergenic
1101585295 12:106080429-106080451 AATTTGCAATTAATAAAAAACGG - Intronic
1101796054 12:107975327-107975349 AATTTGCATATAATTAAAATGGG - Intergenic
1102433962 12:112905785-112905807 AATTTGCACGTATTTAAAAGTGG - Intergenic
1102448993 12:113026528-113026550 AATTTGCATATAATTAAAAATGG - Intergenic
1102449748 12:113032531-113032553 AATTTTCATATAATTAGAAGTGG + Intergenic
1102798518 12:115710683-115710705 AGTTTGCATAGCATTAAAATGGG + Intergenic
1102816167 12:115868190-115868212 TAATTGCATATAATTAAAAACGG + Intergenic
1102851087 12:116246010-116246032 AGTTTCCATATAATAAAAAGAGG + Intronic
1103233901 12:119355753-119355775 AATTTGCATATAATTAAAAATGG - Intronic
1103247091 12:119467052-119467074 ATTCTACATGTAATTAAAAGTGG + Intronic
1103879001 12:124151667-124151689 AATTTGCATGTTATTGAAAGTGG - Intronic
1104249634 12:127079484-127079506 AATTTGCATTTAATTAAAATGGG - Intergenic
1104345384 12:127991821-127991843 AATTTGCATATAATTAAAAGTGG + Intergenic
1104552149 12:129766959-129766981 AACTAGCATATCATTGAAAGTGG + Intronic
1104561145 12:129845909-129845931 AATTTGCATGTAATTAAAAGTGG - Intronic
1104621123 12:130313558-130313580 TATTTTCATGTAATTAAAAGTGG + Intergenic
1104744058 12:131199852-131199874 AATTTCCTTATCATTAAAATAGG - Intergenic
1104756044 12:131269865-131269887 AATTTGCATGTAATTAAGAGGGG - Intergenic
1105672025 13:22629686-22629708 AATTAACATATAATTAAAAGTGG + Intergenic
1105746512 13:23381974-23381996 TCTTTGCCTATTATTAAAAGAGG + Intronic
1105796254 13:23856483-23856505 AATTTGCATTTAAATAACAGTGG - Intronic
1106255269 13:28016650-28016672 AGTTTGCATACATTTAAAAGAGG - Intronic
1106282082 13:28283559-28283581 AATTTTTATATATTTAAAGGGGG - Intronic
1106738144 13:32609081-32609103 AAATTAAATATGATTAAAAGAGG - Intronic
1106820876 13:33463319-33463341 AATTTGTGTATAATTACAAGTGG - Intergenic
1107099093 13:36569325-36569347 AATTTGCATAGATTTGAAAGGGG + Intergenic
1108048455 13:46405749-46405771 AATTTGCATATAATTGAAAGTGG + Intronic
1108096954 13:46912506-46912528 AATCTGCATGTAATTAGAAATGG - Intergenic
1108377719 13:49828861-49828883 AATTTGCATATACTTAAAAGTGG + Intergenic
1108485029 13:50915236-50915258 AATTTGGATAGAAGTAGAAGGGG - Intronic
1108733902 13:53262430-53262452 AATTTCCTTATCATTAAAATGGG - Intergenic
1108773912 13:53739909-53739931 AATCTGCATGAAATTAAAAGTGG + Intergenic
1108811850 13:54235490-54235512 AATGTAAATATAATTAAAAATGG - Intergenic
1108862993 13:54885018-54885040 AATTTGCATGTAATTGAAAGTGG + Intergenic
1109101736 13:58193036-58193058 AATTTGCATATAGCTACATGAGG + Intergenic
1109208157 13:59504833-59504855 CATTTGCAGATAATTCAGAGTGG - Intergenic
1109379127 13:61535468-61535490 AATTAGCACATAATTAAAAGTGG + Intergenic
1109419013 13:62085420-62085442 AATCTGCATGTTATTAAAAGTGG + Intergenic
1109427002 13:62178203-62178225 CATTTGCAGAAAATTAAAACTGG + Intergenic
1110004313 13:70247378-70247400 AATTTGCTTATGAATGAAAGGGG - Intergenic
1110381993 13:74863173-74863195 AATTTGGATATAACTAAAAGGGG + Intergenic
1110550938 13:76810871-76810893 ACTTTTCATATAATGAACAGAGG - Intergenic
1110603118 13:77399359-77399381 AATTGGTATACAAGTAAAAGTGG + Intergenic
1110856035 13:80297728-80297750 GATTTGCATTTAGCTAAAAGTGG - Intergenic
1110988070 13:81999572-81999594 AGTTTGCAGACAAATAAAAGAGG - Intergenic
1110998400 13:82143113-82143135 CATTTGAATGAAATTAAAAGAGG + Intergenic
1111044852 13:82801502-82801524 AATTTACATATACTTATATGTGG - Intergenic
1111131688 13:83985040-83985062 TACTTGCTTATAGTTAAAAGTGG - Intergenic
1111225331 13:85263785-85263807 AATTTGCATGAAATTAAAAATGG + Intergenic
1111263370 13:85773839-85773861 ATTTTGCAGATACTGAAAAGTGG - Intergenic
1111430719 13:88145634-88145656 AATCTGCATGTAATTAAAAGTGG + Intergenic
1111663837 13:91243207-91243229 AATTTGCATGCAATTGGAAGTGG - Intergenic
1111956625 13:94766107-94766129 AGTTTGCACATAATTAAAAACGG + Intergenic
1112022129 13:95380692-95380714 AATTTGCATATAGTCGAAAGTGG - Intergenic
1112139707 13:96625119-96625141 AATTCACACGTAATTAAAAGTGG - Intronic
1112436055 13:99392140-99392162 AGTTGGCAAATAATCAAAAGAGG - Intergenic
1112582481 13:100688409-100688431 AATTTGCATGTGCTTGAAAGTGG - Intergenic
1112583569 13:100697141-100697163 ACTTTGCATGTAATTGAAAGTGG - Intergenic
1112591104 13:100763650-100763672 AATTTGCACGTAATTATAAGTGG + Intergenic
1112751479 13:102588303-102588325 AATTTGCATGCAATTGTAAGTGG - Intergenic
1112910071 13:104471790-104471812 TATTTGCAAATAATTATAGGAGG + Intergenic
1113436097 13:110292332-110292354 AATTTGCATATCATCTCAAGGGG + Intronic
1114113890 14:19502153-19502175 ATTTAGCAAATAATTCAAAGGGG + Intergenic
1114115588 14:19619904-19619926 ATTTAGCAAATAATTCAAAGGGG + Intergenic
1114601101 14:23956027-23956049 AATTTGCATAATCTTAGAAGAGG + Intronic
1114610785 14:24038807-24038829 AATTTGCATAATCTTAGAAGAGG + Intergenic
1114796062 14:25716480-25716502 AATTTTCTTAACATTAAAAGTGG + Intergenic
1114865493 14:26589420-26589442 AATTTACTTGTAATTAAATGTGG + Intronic
1115002306 14:28438094-28438116 AATTTGCTTCTAATTAAAAGTGG - Intergenic
1115002964 14:28443486-28443508 ACTTTGCATATAATTAAAGTGGG - Intergenic
1115091410 14:29581311-29581333 TATTTGCGTATAATTCAAATTGG - Intronic
1116145936 14:41069208-41069230 AATTTGCATGCAATTAAAAGGGG - Intergenic
1116220390 14:42077969-42077991 ATTTTGCAGGTAATTAAAAAAGG - Intergenic
1116239218 14:42320018-42320040 AATCTGTATATAATTGAAATGGG - Intergenic
1116287463 14:42990927-42990949 AATTTTCATGTAATTAAAAGTGG + Intergenic
1116314140 14:43365142-43365164 AATTTACATATATTAAAAAATGG + Intergenic
1116558058 14:46338198-46338220 AATTTGCATGTAATTCAAGTGGG + Intergenic
1116700740 14:48238247-48238269 AACTTGCATATAATTAAAGAGGG - Intergenic
1116762289 14:49028853-49028875 AATATGCCTATCATTAAAGGTGG + Intergenic
1116780053 14:49227107-49227129 CATTTGCATATAATTTTCAGTGG + Intergenic
1117128380 14:52657182-52657204 AATTTGCATATAATAAAAAGTGG + Intronic
1117273119 14:54165433-54165455 AATTTCCATATAAATGAAACTGG + Intergenic
1117792620 14:59357113-59357135 AATTTGCATTTAGTCAAATGAGG + Intronic
1117880643 14:60310095-60310117 AATTTGCATATAATTAAAAGTGG - Intergenic
1118442799 14:65827419-65827441 CATATGTATATAATTAAACGTGG + Intergenic
1118630510 14:67698228-67698250 AATTTGCATATAATTTCAGGTGG + Intergenic
1118632189 14:67715725-67715747 AAGTTGCAAATAATTAAATTAGG + Intronic
1119032700 14:71204977-71204999 AATTTGCATATTATTAAAAGTGG - Intergenic
1119307332 14:73618175-73618197 AATTTTGGTATAATTAAAAATGG + Intronic
1119381245 14:74230175-74230197 AATTTGCATGCAATTTAAAGTGG - Intergenic
1120036728 14:79706352-79706374 TATTTGCATATATTTGAAAGTGG - Intronic
1120060363 14:79975585-79975607 AATTTGCATATAATTAAAAGTGG - Intergenic
1120106559 14:80502026-80502048 AATTTGCATATAATTAAAAGTGG + Intronic
1120204289 14:81571354-81571376 AATTTTCAAAAAATTAATAGAGG + Intergenic
1120296945 14:82653701-82653723 AATTTCCATTTTATAAAAAGAGG + Intergenic
1120327442 14:83049253-83049275 AATTTGCATGTAAATAAAAGTGG + Intergenic
1120550021 14:85858900-85858922 AATTAGCCTATAATTAAGAGTGG + Intergenic
1120813737 14:88831329-88831351 AATTTGCATGTAATTGAAAGTGG + Intronic
1120896539 14:89537789-89537811 AATTTACATATCTATAAAAGAGG + Intronic
1121145801 14:91581277-91581299 AATTTGCCTACAATAAATAGGGG + Intronic
1121257148 14:92539411-92539433 AATTTGCCTATATTTAAAATGGG - Intronic
1121925294 14:97921760-97921782 AATTTGTATATATTTATAAATGG + Intergenic
1122002698 14:98674844-98674866 AATTTGCATATAACTAAAAGTGG - Intergenic
1122331810 14:100923258-100923280 AATGTTCATATAAATAAAAGGGG + Intergenic
1122436456 14:101704408-101704430 AATTTGCATATAATTAAGCATGG + Intergenic
1122562685 14:102627939-102627961 TATATGCATAAATTTAAAAGGGG + Intronic
1122850744 14:104528919-104528941 AATCTGCATGCAATTAAAAGTGG + Intronic
1122962346 14:105100988-105101010 AATTTGCATGTAATTAAAAGTGG + Intergenic
1123180418 14:106464840-106464862 ATTTTGCAAATAATTAATATTGG + Intergenic
1202891266 14_KI270722v1_random:160415-160437 AGTTTTCATAAAATTACAAGAGG + Intergenic
1202946479 14_KI270726v1_random:31823-31845 ATTTTGCAAATAATTAATATTGG - Intergenic
1123829615 15:24121058-24121080 AATTTACATGTAATTGAAAGTGG - Intergenic
1123835200 15:24182951-24182973 AATTTGCATATAATTAAAAGTGG - Intergenic
1123849957 15:24344307-24344329 AATTTGCATGTAATTAAAAGTGG - Intergenic
1123854896 15:24398862-24398884 AATTTGTGTATAATTAAAAGTGG - Intergenic
1123859612 15:24450722-24450744 AATTTACATGTAATTGAAAGTGG - Intergenic
1123870927 15:24571846-24571868 AATTTGCATATAATTAAAAGTGG - Intergenic
1123956840 15:25345240-25345262 AATTTGCAGATGATTACAAAGGG + Intronic
1124016706 15:25883093-25883115 GATTTGCCTGTGATTAAAAGTGG + Intergenic
1124969359 15:34470135-34470157 AAATTGCATATAATCAAAAGGGG + Intergenic
1125130932 15:36283510-36283532 TGTTTGCATATACTTAAAAGTGG - Intergenic
1125410737 15:39403372-39403394 CATTAGCATATATTTAGAAGGGG + Intergenic
1125558205 15:40603837-40603859 AATTTGCATATAATTAAAAATGG - Intronic
1125757984 15:42078048-42078070 AATTTGCATGTAATTAAAAATGG + Intronic
1126060416 15:44775757-44775779 AATATGAATATAAGTAAAATAGG + Intergenic
1126082174 15:44974435-44974457 ACTTTGCATATAATTGTAAAAGG + Intronic
1126984423 15:54287738-54287760 AAATTGCATAAAACTAAAAAAGG + Intronic
1126984502 15:54288618-54288640 AAATTGCATAAAACTAAAAAAGG + Intronic
1127337124 15:57998995-57999017 AATATGCAGAAAATTAAAACTGG + Intronic
1128652065 15:69424144-69424166 ATTCTTCATGTAATTAAAAGTGG - Intronic
1129147968 15:73666460-73666482 AATTTGCATGTAATTAAAAGTGG - Intergenic
1129964698 15:79723853-79723875 AATTTTCATATGATTAAAAATGG - Intergenic
1130361711 15:83193775-83193797 AATTTCCATGTAATTAAAAGTGG + Intronic
1131192016 15:90324481-90324503 AATTTGCATGTAATTAAAAGTGG - Intergenic
1132456542 16:26863-26885 AATTTGTATATAGTTACAAGTGG - Intergenic
1132479009 16:156846-156868 AATTTGCATATAATGAAAAGTGG - Intronic
1133165436 16:3943689-3943711 AATTTGCATGTAATTAAAAGTGG - Intergenic
1133352263 16:5109244-5109266 AATCTGCATGCAGTTAAAAGTGG - Intergenic
1133447875 16:5877738-5877760 AATTTGCATGTAATTAAAAGTGG - Intergenic
1133475232 16:6114942-6114964 AATTTGCATGTAACTGAAAATGG - Intronic
1133498757 16:6345355-6345377 AATTTCCATGTAATTAAAAGTGG - Intronic
1133549305 16:6838487-6838509 AATTTGCATGCAATTAAAAGTGG + Intronic
1133724366 16:8523629-8523651 CATTTGCATGTAATTAAAATTGG - Intergenic
1133728029 16:8555402-8555424 AATTAGTATATCATTAAAAGTGG - Intergenic
1133915534 16:10106259-10106281 AATTTACACATAAGAAAAAGTGG + Intronic
1133970452 16:10564079-10564101 AATTTGCATATACTTAAAAGTGG - Intronic
1134401450 16:13913980-13914002 AATTTTCATATAATGAAAAGTGG - Intergenic
1134749971 16:16618166-16618188 AATTTGCATATCATTAAAAGTGG - Intergenic
1134908867 16:18005874-18005896 AATATACACATAATTAAAATTGG + Intergenic
1134995505 16:18735449-18735471 AATTTGCATATCATTAAAAGTGG + Intergenic
1135151767 16:20013560-20013582 AATTTGCAAAGAATTTGAAGAGG - Intergenic
1135491378 16:22912692-22912714 AATTTGCATGTAATTAGAAGTGG - Intronic
1135536489 16:23298426-23298448 AATTAGCATGTCATTAAAAGTGG - Intronic
1135783433 16:25326501-25326523 GATTTGCATGTAATTAAAAGTGG - Intergenic
1135793373 16:25419212-25419234 AATCTTCATGCAATTAAAAGTGG - Intergenic
1135794216 16:25425903-25425925 AATTTGCATGTAATTAAAAATGG + Intergenic
1135827831 16:25745773-25745795 CTTTTGCATATCATTAAAATTGG + Intronic
1135904583 16:26499474-26499496 AATTTGCATGTAATTAAAAGTGG + Intergenic
1135949309 16:26898385-26898407 AATTTGCATGTAATTAAAAATGG + Intergenic
1135980607 16:27143978-27144000 AATTTGCATTTAATTAAAAGTGG - Intergenic
1135999703 16:27282620-27282642 AATTTCCAAATCATAAAAAGGGG - Intronic
1136358475 16:29762104-29762126 AATTTGCATGTGATTGAGAGTGG + Intergenic
1136359960 16:29772660-29772682 AATTTGGAAATAATGAAGAGAGG - Intergenic
1136646920 16:31628772-31628794 AGTTTGCATGTAATGAAAAGTGG + Intergenic
1136658262 16:31727502-31727524 AGTTTGCATGTAATGAAAAGTGG - Intronic
1136689377 16:32017939-32017961 AATTTGCATACAATTAAAAGTGG + Intergenic
1136789969 16:32961481-32961503 AATTTGCATACAATTAAAAGTGG + Intergenic
1136879843 16:33892455-33892477 AATTTGCATACAATTAAAAGTGG - Intergenic
1136901668 16:34046101-34046123 CATTTGAGTATAATTAAGAGAGG - Intergenic
1137357237 16:47778485-47778507 AATTTGCATATAATTAAAAGTGG - Intergenic
1137772801 16:51030584-51030606 ATTTTGCATATAATTAAAATTGG - Intergenic
1137948477 16:52758604-52758626 AATTTGCATATGTTTTAAAAGGG - Intergenic
1138005761 16:53335730-53335752 AAATTGTATATATTTAAAAGTGG + Intergenic
1138019445 16:53464682-53464704 AATTTTCATAAAATAAAAAAAGG - Intronic
1138729323 16:59177398-59177420 AAGTTACAAATAATTAAAAGGGG - Intergenic
1138777430 16:59740888-59740910 AATTTGCATAAAATTGAAAGTGG - Intronic
1138801079 16:60030823-60030845 AAATTTGATATAATCAAAAGTGG + Intergenic
1138814327 16:60186830-60186852 AATTTGAGTATAATTAAACGTGG + Intergenic
1138850813 16:60627442-60627464 AATTTGCGTACAATTAAAAGCGG - Intergenic
1138859291 16:60735934-60735956 AATTTGCATGCAATTAAAAGTGG + Intergenic
1138977536 16:62226035-62226057 AATTTGCATGTAATTAAAAGTGG + Intergenic
1139037545 16:62965898-62965920 ACTTAGCATATAATTAAAAGTGG - Intergenic
1139120193 16:64007118-64007140 AATTTGAATATATTTGAAGGTGG + Intergenic
1139681754 16:68570455-68570477 GATTTGCATGTAATTAAAAATGG - Intronic
1139685949 16:68603869-68603891 AATTTTGATATAATTTTAAGTGG - Intergenic
1139827979 16:69772605-69772627 AACTTGCATATAATTAAAACTGG - Intronic
1139947159 16:70649295-70649317 AATCTGCATGCAATTAAAGGTGG - Intronic
1140020852 16:71237330-71237352 AATTTGCATATAATTTACAGTGG - Intergenic
1140033318 16:71355405-71355427 AAGGTGCATATAGTTTAAAGAGG - Intergenic
1140276789 16:73516430-73516452 AATTTGCATACAAGGTAAAGTGG - Intergenic
1140300589 16:73753502-73753524 AATTTTCATGTAATTAAAAGTGG + Intergenic
1140339807 16:74146500-74146522 AATTTGCATGTAATTAAAAGTGG + Intergenic
1140348667 16:74240487-74240509 AATTTGTTTATAATTAAAAGTGG - Intergenic
1140537837 16:75727166-75727188 AATTTTCATATAAATAAGATAGG - Intronic
1140543279 16:75780116-75780138 AATCTGCATGCAATTAAAAATGG + Intergenic
1140838752 16:78819504-78819526 AATTTGCATATAATTAAAAATGG + Intronic
1141410947 16:83832741-83832763 AATTTGCATGTAATTAAAAGTGG + Intergenic
1142109698 16:88324673-88324695 AATTCGCACATACTTAAAAGTGG - Intergenic
1142158011 16:88541529-88541551 AATTTGCATGTAATTGAAGAGGG - Intergenic
1142162615 16:88566455-88566477 AATCTGCATGTAATTAAAAGTGG + Intergenic
1142294299 16:89210327-89210349 AATTTGCATATAATTAAAAGTGG + Intergenic
1203092172 16_KI270728v1_random:1222944-1222966 AATTTGCATACAATTAAAAGTGG + Intergenic
1142774471 17:2125480-2125502 AAATTGAATATAATTAAAAACGG + Intronic
1143362189 17:6381209-6381231 ACTCTGCATATAAATATAAGAGG - Intergenic
1143368607 17:6424381-6424403 AATCTACATGTAATTAAAAGTGG + Exonic
1143437822 17:6942271-6942293 AATTTGCATATAATTAGAAGTGG + Intronic
1143441572 17:6978652-6978674 AATTAGCATGTCACTAAAAGTGG + Intronic
1143895767 17:10135137-10135159 AATCTACATGTAATTAAAAGAGG - Intronic
1144035733 17:11363870-11363892 AATTTGCATGTAATTAAAAGTGG + Intronic
1144281094 17:13727261-13727283 CATTTGCATGTAAATGAAAGTGG - Intergenic
1144283980 17:13754983-13755005 AATTTGCTTAAAATTAATATAGG + Intergenic
1144413564 17:15024160-15024182 GATGTACATGTAATTAAAAGTGG - Intergenic
1144424862 17:15132311-15132333 AATTTGCATGTAATTGAAAGTGG + Intergenic
1144722121 17:17478429-17478451 AATTTGCTTAAACTCAAAAGTGG - Intronic
1145821798 17:27843036-27843058 AAATTGACTAAAATTAAAAGGGG + Intronic
1145849490 17:28078306-28078328 ATTTATCATATAATCAAAAGAGG - Intronic
1146087978 17:29847902-29847924 AATTTACATGTAATTGAAAGTGG + Intronic
1146658312 17:34648347-34648369 AATTTGCATATAATTAATAGTGG - Intergenic
1146770319 17:35562772-35562794 AATTTACATATTTTTAATAGAGG + Intergenic
1147152223 17:38524084-38524106 AATTTGCATACAATTAAAAGTGG + Intergenic
1147431636 17:40375019-40375041 AATTTGCATATAACTAAAAGTGG - Intergenic
1147445464 17:40472606-40472628 AATTTGCATGTGTTTAAAAGTGG - Intergenic
1147641615 17:42005568-42005590 TATTTGCAGATTATTAAAACAGG + Intronic
1148668667 17:49393767-49393789 ATTTTGCATATAATTAAGAGTGG + Intronic
1148931116 17:51128153-51128175 ATTTTGCATGTGATTATAAGTGG - Intergenic
1149270742 17:54974857-54974879 AATTTGCATATAATTAAAAGCGG - Intronic
1149895780 17:60427234-60427256 AATTTGCAAGTAATTAAAAGCGG - Intronic
1150049899 17:61951695-61951717 AATTTGCTTAAAAGTAAAAATGG + Intronic
1150062212 17:62078145-62078167 AATTTGCATGTAATTAAAAGTGG + Intergenic
1151077711 17:71293348-71293370 AATTTGCACATAATTAAAAGTGG + Intergenic
1151336869 17:73444979-73445001 AATTTACATTTAATTAAGAATGG + Intronic
1151463728 17:74271352-74271374 AATTTGCATGTAATTAAAAATGG - Intergenic
1151775145 17:76196019-76196041 AATTTGCACATAATTAAAAGTGG + Intronic
1151883612 17:76910363-76910385 CATTTGCAGATTATGAAAAGAGG + Intronic
1152009606 17:77703894-77703916 AATTTGCATGTAATTGAAAGTGG - Intergenic
1152044485 17:77927039-77927061 AATCTGCATGCAATTAAAAGTGG - Intergenic
1152171719 17:78754737-78754759 ATTTTGCATAAATTTAAAAATGG - Intronic
1152292263 17:79446680-79446702 AATTTGCATGCAATTAAAAGTGG + Intronic
1152382619 17:79949982-79950004 AATTTGCACATATTTACAAGGGG + Intronic
1152415837 17:80161236-80161258 GATTAGCATATAATTAAGACCGG - Intergenic
1152803578 17:82343783-82343805 AATTTGCATGTAGTTAAAAGTGG + Intergenic
1152930385 17:83106345-83106367 AATTAGCATGTCATTAAAAGTGG - Intergenic
1153099103 18:1444730-1444752 AATTTATATATACATAAAAGTGG - Intergenic
1153129734 18:1841192-1841214 AATTTGCATATAATTAAAAGTGG + Intergenic
1154086233 18:11308160-11308182 AATTGGCATATAGTTAAAATTGG + Intergenic
1155523934 18:26697535-26697557 AATTTGCATGTAATTGAAAGTGG - Intergenic
1155679942 18:28476219-28476241 AATTTGCATATAATTAAAAATGG + Intergenic
1155680885 18:28483964-28483986 AATTTGTATACAATTAAAAGTGG + Intergenic
1155730890 18:29156836-29156858 AAGTTGCAGCTAATGAAAAGCGG + Intergenic
1156024808 18:32640144-32640166 AAGGTGGATATAATTATAAGAGG - Intergenic
1156222780 18:35070433-35070455 TATTGGCATGTAATTAAAGGGGG + Intronic
1156558445 18:38093689-38093711 AATTTGTTCATAATTGAAAGGGG - Intergenic
1156590506 18:38482692-38482714 AATTTGCAGGGAAGTAAAAGGGG + Intergenic
1156644773 18:39147847-39147869 AATTTCCATATAGTTAAAAGTGG - Intergenic
1156645133 18:39151915-39151937 AATTTGTGTATAATTAAAAGTGG - Intergenic
1156666443 18:39413623-39413645 AATATACATAGAATTCAAAGTGG + Intergenic
1156841039 18:41609619-41609641 AATTTGCATTTGATTCAAAGTGG - Intergenic
1157011921 18:43659722-43659744 AATTTGCATTACATAAAAAGAGG - Intergenic
1157076305 18:44471411-44471433 AATTTGCATGTAATTGAAAGTGG + Intergenic
1157127918 18:44974670-44974692 TATTTGTATATATTTAAAAGAGG + Intronic
1158234382 18:55296808-55296830 AAACTGCATATAATTAAGTGTGG + Intronic
1158348045 18:56535606-56535628 AATTTATATATATATAAAAGAGG - Intergenic
1158367913 18:56760678-56760700 GTTTTGTATATAACTAAAAGTGG + Intronic
1159108470 18:64029286-64029308 AATTTGCATGTAATTATAAGAGG - Intergenic
1159127656 18:64243639-64243661 GATTAGCATATAATTATAATCGG + Intergenic
1159183556 18:64942517-64942539 AATTTGCATGTAAATAACAGTGG - Intergenic
1159184447 18:64950420-64950442 AATTTGCATGTAAGTAATAGCGG - Intergenic
1159185970 18:64974711-64974733 AATTTGCATGTAATTAAAAGTGG + Intergenic
1159246996 18:65819258-65819280 GATTTGCATGTAATTGAAATTGG + Intronic
1159262936 18:66039367-66039389 AATTTGCATATAATTAAAAGTGG + Intergenic
1159337076 18:67082055-67082077 AATTTGCATGCAATTGAATGTGG + Intergenic
1159503111 18:69298968-69298990 AATTTGCATGTAATTAAAAGCGG + Intergenic
1159649142 18:70956603-70956625 AATTTGCAAATCATTAAAGGTGG - Intergenic
1159653340 18:71003335-71003357 AACCTGCATGCAATTAAAAGTGG + Intergenic
1159902505 18:74060763-74060785 AGTTTGCATGTAATTTAAAGTGG + Intergenic
1159944471 18:74433876-74433898 AATTTGGATACAACTTAAAGAGG + Intergenic
1160062870 18:75548672-75548694 AATTTGCATGTAATTGAAAGTGG + Intergenic
1160481372 18:79243308-79243330 AATATGCATTTAATTGCAAGGGG + Intronic
1160617926 18:80147993-80148015 GGTTTGCATATAATTAACAGTGG + Exonic
1161248116 19:3266109-3266131 AATTTAAATGTAATTAAAAGTGG - Intronic
1161525791 19:4754249-4754271 AATTTGCATATAATTAAAAGTGG - Intergenic
1161859982 19:6790760-6790782 GATTTGCATATAATTAAAACGGG - Intronic
1161861774 19:6803266-6803288 AATTTGCATATAATTAAAGTGGG - Intronic
1162089565 19:8270136-8270158 AATCTGCATGCGATTAAAAGTGG + Intronic
1162219525 19:9164319-9164341 AATTTGCATGTAATTAAAACTGG - Intergenic
1162663019 19:12185120-12185142 AATTTGCATATAATTGAAAGTGG - Intronic
1162880433 19:13654812-13654834 AATTTACACATAATTAAAAGTGG - Intergenic
1162990762 19:14300615-14300637 AATTTGCATATAATTAAAAATGG + Intergenic
1163115029 19:15184161-15184183 AGTTTCCATATAAATAAAACGGG + Intronic
1163332561 19:16650157-16650179 AATTTTCATAAAATAACAAGAGG - Intronic
1163512444 19:17743598-17743620 CATTTGCATATAATTAAAAGTGG - Intergenic
1163568317 19:18065034-18065056 CATTTGCATATAATTAAAAGCGG + Intronic
1164068274 19:21740858-21740880 ATTTCTCAAATAATTAAAAGTGG + Intronic
1164412125 19:28014780-28014802 AATCTACATGTGATTAAAAGTGG + Intergenic
1164454574 19:28396598-28396620 AATTTGCATATAATTACAGGTGG + Intergenic
1164561005 19:29292255-29292277 AATTTGCATGTCATTAAAAGTGG - Intergenic
1164572507 19:29384735-29384757 AATCTGCATGTAATTAAAAGTGG - Intergenic
1164675790 19:30100348-30100370 AATTTGCACGTGATTGAAAGTGG + Intergenic
1164855826 19:31519966-31519988 AATTTGCATGTAATTAAAAGTGG - Intergenic
1164878888 19:31714239-31714261 GATTTGCTTTTAATTAAAATAGG + Intergenic
1164897515 19:31890212-31890234 ACTCTGCATGTAATTAAAAGTGG - Intergenic
1165103146 19:33451013-33451035 ACTCTGCATGTAATTAAAAGTGG + Intronic
1165134742 19:33660738-33660760 AGTTTGCATGCAATTGAAAGTGG + Intronic
1165278612 19:34776843-34776865 AATCTGCATGTAATTAAAAGTGG - Intergenic
1165881373 19:39046358-39046380 AATTTGCATGTAACTGAAAGTGG + Intergenic
1166353629 19:42214147-42214169 AAATTTCACATAATAAAAAGAGG + Intronic
1166648317 19:44549450-44549472 CATTTGTATATAATTTCAAGGGG + Intergenic
1166649292 19:44559415-44559437 CATTTTAAAATAATTAAAAGAGG + Intergenic
1166955281 19:46460122-46460144 AATTTGCATATAATTAAAAGTGG - Intergenic
1166957247 19:46472734-46472756 AATTAGCACGTCATTAAAAGTGG - Intergenic
1167082934 19:47289712-47289734 GATTTGCATATAATTAAAAGTGG - Intergenic
1167652488 19:50740371-50740393 AATTTGCATATAATTAAAAGTGG + Intergenic
1167677892 19:50899687-50899709 AATTTGCATGTAATTGAAAGTGG - Intergenic
1167692426 19:50994649-50994671 AATTTGCATGTAATTGAAAATGG + Intergenic
1167819172 19:51910345-51910367 ACTTTGCATATAATTAAAAGTGG + Intronic
1167975914 19:53225863-53225885 AGTTTGCATGTAATTAAAAGTGG + Intergenic
1168582789 19:57569372-57569394 CCTTTGCATGTAGTTAAAAGCGG + Intergenic
1202698276 1_KI270712v1_random:141859-141881 AATTTGCATATAAAAAAGACTGG - Intergenic
925027111 2:618750-618772 AATCTGCATGCAATTAAAAGTGG + Intergenic
925475261 2:4206263-4206285 TATTTGCATATAATTAAAAATGG - Intergenic
926115746 2:10212155-10212177 AATTTGCATGTAATTAAAAGTGG + Intergenic
926144636 2:10389239-10389261 AATTTGCATGTAATTAAAAGTGG + Intronic
926340882 2:11903376-11903398 AATCTGCATGCAATTAAAAGTGG + Intergenic
926438339 2:12860482-12860504 AATTTGCATATACTTAAAAGTGG - Intergenic
926564453 2:14454412-14454434 AATTTGCATGTAATTAAAAATGG + Intergenic
926831159 2:16963631-16963653 TACTTGCATCTAGTTAAAAGAGG - Intergenic
927033506 2:19147774-19147796 AATTTGCTAATAATTGACAGTGG - Intergenic
927382359 2:22493459-22493481 AATCTGCATGTTATTAAAAGTGG + Intergenic
927536969 2:23870591-23870613 AATTTGGATGTAATTTAAATTGG - Intronic
927622340 2:24675122-24675144 AATGTGCACAGAATTAAAAAAGG - Intronic
927671103 2:25069638-25069660 AATCTGCATATAATTAAAAGTGG - Intronic
928386690 2:30875126-30875148 CATTTGCAGAAAATTAAAACTGG - Intergenic
928473816 2:31603211-31603233 AATTTACAAAAAATTAAAAGTGG + Intergenic
928565300 2:32539687-32539709 TAAATGCATATAATTAAAAGAGG + Intronic
928788759 2:34924604-34924626 AATTTGTATATAGTGAATAGTGG - Intergenic
928843542 2:35640352-35640374 CATTTGCATATCATTAATAATGG + Intergenic
928917353 2:36486749-36486771 AATTTTCATCTAATCAACAGAGG + Intronic
929093816 2:38245318-38245340 AAGTAGCATGTCATTAAAAGTGG + Intergenic
929304720 2:40347938-40347960 AAATTGCTTATAATTTCAAGTGG - Intronic
929623573 2:43383046-43383068 AATGTTCAGATATTTAAAAGTGG + Intronic
929712662 2:44280569-44280591 AATTTGAGTATAATTCAAATAGG - Intronic
930072580 2:47379693-47379715 AATTTGTATGTAATTATATGTGG + Intronic
930278712 2:49343653-49343675 ACTCTGCATAAAATTTAAAGAGG - Intergenic
930444001 2:51447335-51447357 AATTTGGATAAAATGCAAAGTGG + Intergenic
930682923 2:54276754-54276776 AATTTGAAAATAATTAAAAAAGG + Intronic
930863715 2:56102523-56102545 AATTTGCTTGTAATTGAAAGTGG + Intergenic
930891180 2:56389705-56389727 AATCTGCATGCAATTAAAAGTGG - Intergenic
930903087 2:56532012-56532034 AATTTGCATGTAATTGGAAGTGG - Intergenic
931072623 2:58670065-58670087 AATTTGCATGTAATTAAAAGTGG - Intergenic
931821230 2:65954431-65954453 ACTTTGCATGGAATAAAAAGTGG - Intergenic
931965437 2:67528697-67528719 AATTTGCATATAATTGGAAATGG + Intergenic
931972128 2:67600481-67600503 AATTTGTATGTAATTATAAGTGG - Intergenic
932789876 2:74645666-74645688 AATTTGCATGTAATTAAAACTGG + Intronic
933032838 2:77354026-77354048 AATTTGCATGTAATTAAAAGTGG - Intronic
933192690 2:79353619-79353641 AATTGGCATAGAATGACAAGTGG - Intronic
933670181 2:84999695-84999717 TATTTGCATATAAGAGAAAGGGG + Intronic
933941891 2:87251993-87252015 AACTTGCATGTAATTAAAAGTGG - Intergenic
934134480 2:88982534-88982556 TATTAGCATGTCATTAAAAGTGG - Intergenic
934139548 2:89032365-89032387 AATTATCACATGATTAAAAGTGG - Intergenic
934145579 2:89090095-89090117 AATTATCACATGATTAAAAGTGG - Intergenic
934223679 2:90110476-90110498 AATTATCACATGATTAAAAGTGG + Intergenic
934229693 2:90168177-90168199 AATTATCACATGATTAAAAGTGG + Intergenic
934235826 2:90231246-90231268 TATTAGCATGTCATTAAAAGTGG + Intergenic
934279528 2:91599642-91599664 AATTTGCATATAAAAAAGACTGG - Intergenic
934719932 2:96566824-96566846 AATTTGCATATAATTAAAAGTGG + Intergenic
934890435 2:98063624-98063646 AATTTGCATATAATTAAAAGTGG + Intergenic
935120322 2:100178421-100178443 AATTTGCATATAATTGAAAGTGG + Intergenic
935288433 2:101587850-101587872 AATTTGCACATAATTAAAAGTGG - Intergenic
935480333 2:103580198-103580220 AATTTTAATACAATTAAAAGTGG + Intergenic
935876614 2:107514629-107514651 AATTTTCATGTAATTAAAAGTGG + Intergenic
936338331 2:111609576-111609598 AACTTGCATGTAATTAAAAGTGG + Intergenic
936344939 2:111668278-111668300 AATTTGCATGTAATTAAAAGTGG + Intergenic
936485820 2:112924710-112924732 AATCTGCATATAAATATAAGAGG + Intergenic
936595451 2:113842953-113842975 AATTAGGATATAGTTAAAGGAGG + Intergenic
936737034 2:115457799-115457821 CATTGGCATATAAATAACAGTGG - Intronic
936820384 2:116512524-116512546 AATATTCAGAAAATTAAAAGAGG - Intergenic
936923994 2:117718270-117718292 ATTATTCCTATAATTAAAAGAGG + Intergenic
937634176 2:124137342-124137364 TATTTGCATATAAATGAAAAAGG + Intronic
938255460 2:129856553-129856575 AATTTGCATGGAATTTTAAGAGG + Intergenic
938602674 2:132858339-132858361 ATTTTGCATAAACTTAAGAGAGG - Intronic
938710762 2:133974483-133974505 ATTTAGCATATAATTAAGAGTGG - Intergenic
938779540 2:134572914-134572936 TAACTGCATATATTTAAAAGAGG - Intronic
939287479 2:140151901-140151923 AATTTGGATATCATTCAAGGTGG + Intergenic
939359976 2:141158591-141158613 CCTTTGTATATACTTAAAAGAGG - Intronic
939387958 2:141525976-141525998 AATCTTCATATAATTCAATGAGG + Intronic
939539852 2:143480551-143480573 AATCTGGAAATAATTGAAAGAGG - Intronic
940122870 2:150287114-150287136 AATTTGCATATAATTCAAAGTGG - Intergenic
940123849 2:150300063-150300085 AATATGCATATAATTAAAAGTGG + Intergenic
940243228 2:151586041-151586063 CATTTGGATGTAATTAAAAATGG + Intronic
940244184 2:151596594-151596616 CATTTGGATGTAATTAAAAATGG + Intronic
940354128 2:152719360-152719382 AAAGTGCATATAATTAAAATAGG + Intronic
940566672 2:155371686-155371708 AAATTGCATTTTATTAAAAAGGG - Intergenic
940614776 2:156036689-156036711 AAATTGCATAAAATTAGAAGTGG + Intergenic
941428613 2:165383664-165383686 AATGTGCAGATTAATAAAAGTGG + Intronic
941714555 2:168749941-168749963 AATGTGAATGTAATTAAAAGTGG - Intronic
941767797 2:169317075-169317097 AATTTTTATATCATTAAAAATGG + Intronic
942380006 2:175380558-175380580 TATTTTCATATAATTTAAATGGG + Intergenic
942421326 2:175811097-175811119 AGTTTCCAAATAATTAGAAGAGG - Intergenic
942821379 2:180119990-180120012 AATTAGGGTATAAATAAAAGGGG - Intergenic
942944177 2:181655759-181655781 AATTTGTATTTAGCTAAAAGAGG + Intronic
943226897 2:185188980-185189002 AAATTCCATATAATTGTAAGAGG - Intergenic
943261174 2:185665555-185665577 AATTTGCATATAATTAAAATTGG + Intergenic
943379404 2:187124846-187124868 AATTTGCTTATAATTAAACAAGG + Intergenic
943433630 2:187835058-187835080 ACTTAGCATACCATTAAAAGCGG - Intergenic
943442909 2:187947977-187947999 AATCTGCATGCAATTAAAAGTGG + Intergenic
943469330 2:188274401-188274423 AGTCTGCATGTAATTAAAAGTGG + Intergenic
943841616 2:192590529-192590551 AATTTGCAAATAAATAAACTAGG + Intergenic
943849355 2:192697301-192697323 ATTTTGCATATAGTTGAAGGGGG - Intergenic
943883612 2:193181972-193181994 AATTTGCGTGTGATTAAAGGTGG + Intergenic
943883723 2:193183444-193183466 AATTAGCATATAATTAAGAGTGG - Intergenic
944173898 2:196808268-196808290 AATTTGCATATATTCAAAAGTGG - Intronic
944373782 2:199015730-199015752 AATTTACATATGATAAAAATAGG - Intergenic
944435240 2:199681764-199681786 AATTTGTATGTTATTTAAAGTGG - Intergenic
944506316 2:200415697-200415719 AATTTGAATATAATTTAATTAGG + Intronic
944649668 2:201816939-201816961 AATTTGCATATAACTAAAAGTGG + Intronic
945322653 2:208443299-208443321 AATTTGGATAAAATTAAAAATGG - Intronic
945612976 2:212029135-212029157 AATCTGCATGTAATTAAAAGTGG + Intronic
945738250 2:213628757-213628779 AATTGGCATTGATTTAAAAGTGG - Intronic
945772772 2:214065701-214065723 AACATGCATAAAATTAACAGAGG - Intronic
945849969 2:214993565-214993587 TATTTGAATATAATTAAGTGGGG + Intronic
946058848 2:216924322-216924344 AGTTTGCATATAATTAGAAGTGG + Intergenic
946521644 2:220471321-220471343 TATTTTCATATAATTGAAATGGG - Intergenic
946634777 2:221712610-221712632 AATTTGCATTTTATTCTAAGAGG - Intergenic
946805879 2:223470997-223471019 AATTTGCATGTAATTAAAAGTGG - Intergenic
946806663 2:223477334-223477356 AATTTGCATGTAATTAAAAGTGG - Intergenic
946887853 2:224242120-224242142 AATTTGCATATAATTAAAAATGG + Intergenic
946928607 2:224650303-224650325 AATTTGCATATAATTAAAATTGG + Intergenic
947384345 2:229576368-229576390 ACTTTTAATATAATAAAAAGGGG + Intronic
947617180 2:231565704-231565726 AATTTGCATGTAATTAAAAGTGG - Intergenic
948107989 2:235430433-235430455 AATTTGCATGTAATTAAAAGTGG - Intergenic
948529389 2:238594614-238594636 ATTTAGCATATAATTAAGAGTGG + Intergenic
948557530 2:238823833-238823855 AATTTGTATGTAATTAAAAGTGG + Intergenic
948675881 2:239596393-239596415 AATCTGCATGCAATTAAAAGTGG - Intergenic
948880527 2:240855056-240855078 CATTTGCATGTCACTAAAAGTGG - Intergenic
1168884739 20:1240816-1240838 AATCTGCATACAATTAAAAGTGG + Intronic
1168909422 20:1435253-1435275 AATTTGCATGTAATTAAAAATGG + Intergenic
1169035420 20:2447177-2447199 AATTTGCATGTAATTGTAAGTGG + Intergenic
1169501857 20:6168217-6168239 AATTTGCATATAATTAAAAGTGG - Intergenic
1169585123 20:7073393-7073415 AATTTCCATAAAATGATAAGTGG - Intergenic
1169738482 20:8864115-8864137 AATTTTAAAATAACTAAAAGAGG - Intronic
1169812036 20:9618267-9618289 AATTTGATTATAATTTAGAGGGG - Intronic
1170121722 20:12919492-12919514 AATTTGTATGTCATTAAAAGTGG + Intergenic
1170452328 20:16496513-16496535 AAATTGCAAACAATTAAAATGGG + Intronic
1170461569 20:16581638-16581660 AATTTGCATATAATTAAAAGTGG - Intergenic
1170530983 20:17291235-17291257 ATTTTGTATATACATAAAAGAGG - Intronic
1170610782 20:17911107-17911129 CATTCGCATATAATTAACAGTGG + Intergenic
1170753693 20:19176782-19176804 AATTTGCATGTAATTATGAGTGG + Intergenic
1171022188 20:21595831-21595853 AATTAGCATGTGATTCAAAGTGG - Intergenic
1171171009 20:23015399-23015421 AATTTACATGTAATTAAAACTGG - Intergenic
1171401908 20:24879086-24879108 AATGTGCATATAAAGAAATGAGG - Intergenic
1172199234 20:33113552-33113574 AACTAGCATGTAATTAAAAGTGG - Intergenic
1172246777 20:33450857-33450879 AATTTGTGTATAATTAAAAGTGG - Intergenic
1172319624 20:33986203-33986225 AATTTGCATGTAATTAAAAGTGG + Intergenic
1172514800 20:35525851-35525873 AATTTGCATGTAGTTAAAAGTGG - Intronic
1172570703 20:35968140-35968162 AATTTGCATGTGATTGAAAGTGG - Intronic
1172582895 20:36062610-36062632 AATTTGCATGTAAATAAAAGTGG + Intergenic
1172803847 20:37597428-37597450 AATTTGCGTATAATTAAAAATGG + Intergenic
1173486389 20:43444405-43444427 AATTTGCATGTAATTAAAAGTGG + Intergenic
1173651386 20:44667377-44667399 ACTCACCATATAATTAAAAGAGG - Intergenic
1173887008 20:46468590-46468612 AATTTGCATATATTTAAAAGTGG - Intergenic
1173891981 20:46519808-46519830 AATTTACATGTAATTGAAAGTGG + Intergenic
1174140788 20:48412266-48412288 AATTAGCATATAATTAAAAGTGG + Intergenic
1174215090 20:48910447-48910469 CATTAACATATAATTATAAGTGG - Intergenic
1174344082 20:49916701-49916723 ACATTGCAGATAATTAAGAGAGG - Intergenic
1174431183 20:50470511-50470533 CATTAGCATATAATTAAGAGTGG - Intergenic
1174937864 20:54892258-54892280 ATTTTTCATATAAATAAAAGTGG + Intergenic
1174949317 20:55027367-55027389 AATTAGCATGTCAGTAAAAGTGG - Intergenic
1174950508 20:55036646-55036668 AGTTAGCATGTCATTAAAAGTGG - Intergenic
1175096190 20:56543397-56543419 AATATGCAAATAATTACAATGGG + Intergenic
1175138120 20:56840184-56840206 AATTTGCATTTAATTAAAAGTGG - Intergenic
1175292718 20:57888690-57888712 CATTTGCATATAATTGGAGGTGG + Intergenic
1175509616 20:59515044-59515066 ACTTTGCATGTAATTAAAAGTGG - Intergenic
1175569393 20:60007527-60007549 AATTTGCATGTAATTGAAAGTGG - Intronic
1175675435 20:60942721-60942743 AATCTGCATGTTATTAAAAGTGG + Intergenic
1176004248 20:62851130-62851152 AATATGCATCCAAGTAAAAGGGG + Intronic
1176212966 20:63934231-63934253 TGTTTCCCTATAATTAAAAGAGG + Exonic
1176518024 21:7800887-7800909 AATTTGCATATAATTAAAAGTGG - Intergenic
1177047220 21:16185391-16185413 AATTAGCATATAATTATTGGTGG + Intergenic
1177355764 21:20004728-20004750 AATTTGCATGTAATTGAAGTGGG + Intergenic
1177368337 21:20168313-20168335 AATTTGCATATAATTTAAAGAGG + Intergenic
1177746208 21:25216424-25216446 AATGTGGCTATAATTAAAATAGG + Intergenic
1177794937 21:25765516-25765538 AATTTCCATATAATTATATTGGG - Intronic
1177925400 21:27208205-27208227 AATGAGCATATAACTGAAAGAGG + Intergenic
1178042346 21:28653029-28653051 AATTTGCATGTAATTGAAAGTGG + Intergenic
1178055312 21:28792014-28792036 AATTAGCATATAATGAGCAGTGG - Intergenic
1178208486 21:30499267-30499289 AAATTGCATTAAACTAAAAGTGG + Intergenic
1178240416 21:30893470-30893492 TATTTGCATGTAATTAAAAGTGG + Intergenic
1178652052 21:34430900-34430922 AATTTGCATATAATTAAAAGTGG - Intergenic
1178974640 21:37210328-37210350 AATTTACATATAATTAAAAGTGG - Intergenic
1179037272 21:37769329-37769351 AAGTTGTATAAAACTAAAAGGGG - Intronic
1179214344 21:39353473-39353495 AATTTGCTTATAGTTTACAGTGG - Intergenic
1179413546 21:41180109-41180131 CATTTGCATATAATTAAAAGTGG - Intronic
1179427361 21:41292321-41292343 AATTTGCATATAATTAAAAGTGG - Intergenic
1179718796 21:43303857-43303879 AATTTTCATATGGTTAAAAACGG - Intergenic
1180467159 22:15622154-15622176 ATTTAGCAAATAATTCAAAGGGG - Intergenic
1181447601 22:22990046-22990068 AATCTGCATGTTATTAAAAGTGG - Intergenic
1181483168 22:23213915-23213937 AATTTCAACATAATTCAAAGTGG - Intronic
1181595174 22:23909577-23909599 ATTTAGCATATAATTAGCAGGGG - Intergenic
1181753663 22:25007761-25007783 GACTTGCATGTAATTAAAAGTGG + Intronic
1181754917 22:25016994-25017016 AATTTGCATATAATTAAAAGTGG - Intronic
1181910015 22:26231191-26231213 AATTTGCATGTAATTAAAAGTGG - Intronic
1182029600 22:27147477-27147499 AATTTGCATATAATTAAAAGTGG + Intergenic
1182111092 22:27724273-27724295 AATTTGCATGTAATGAGAAGTGG - Intergenic
1182186275 22:28405859-28405881 CATTTGCATGTAATTAAAAGTGG + Intronic
1182192182 22:28473552-28473574 GATTTGCATATAATTAAAAGTGG + Intronic
1182743796 22:32589017-32589039 AATTTGCATGTAATTAAAATGGG + Intronic
1182971591 22:34584285-34584307 AATTTGCATATAATTAAAAGTGG - Intergenic
1183336456 22:37250210-37250232 AATTTGCATGTGACTAAAAGTGG + Intergenic
1183356009 22:37359928-37359950 AATTTGCATGTGATGAAAAGTGG - Intergenic
1183560077 22:38565492-38565514 AATTTGCACGTAATTAAAAGTGG + Intronic
1183566922 22:38622149-38622171 AATTTGCCTGTAATTAAAAGTGG + Intronic
1183609346 22:38887605-38887627 AATTTGCATGGAATCAAAAAAGG + Intergenic
1183676605 22:39302294-39302316 CATTTGCATATAATTAAAGTAGG + Intergenic
1183703966 22:39465595-39465617 AATTTCCATATAGTGAAATGAGG + Intronic
1184434842 22:44464946-44464968 AATTTGCATGTAATTAAAAGTGG - Intergenic
1184612739 22:45615421-45615443 AATGTACATATAATTAAAAGTGG - Intergenic
1184632473 22:45793991-45794013 AATTCGCATATAGTTAAAAGTGG - Intronic
1184866912 22:47206474-47206496 AATTTACATGTAATTAAAAGTGG + Intergenic
1184964064 22:47954209-47954231 AATTTGCATATAATTAAAAGTGG - Intergenic
1185006971 22:48285011-48285033 ATTTTGCATATAACTAAAAGGGG + Intergenic
1185131895 22:49044021-49044043 AATTAGCATGTAGTTAAAAGTGG - Intergenic
1185242919 22:49756006-49756028 AATTTGCATGTAATTGAAAGTGG + Intergenic
1185300064 22:50074885-50074907 AATTAGCATATACTTAAAAGTGG + Intronic
949201370 3:1383792-1383814 AATTTGCATGTAATTAGAAGTGG - Intronic
949255097 3:2036379-2036401 AATTTGCATATAATTAAAAGTGG + Intergenic
949561874 3:5210283-5210305 AATTTGAAATAAATTAAAAGTGG - Intronic
949602371 3:5614013-5614035 AATTGGATTATAATTAAGAGCGG + Intergenic
949712281 3:6885330-6885352 AATTTGCATATAATTAAAAGTGG - Intronic
949737230 3:7187662-7187684 AATCTGCATGTAATTAAAAGTGG - Intronic
949779953 3:7675058-7675080 AATTTTTATATAGATAAAAGTGG + Intronic
950629742 3:14274566-14274588 AATTTGCATATAATCAAAAGTGG - Intergenic
950685060 3:14611051-14611073 AATTTGCATGTAATAAAAAGTGG - Intergenic
950705272 3:14775605-14775627 ATTTAGCATATAATTAAGAGTGG - Intergenic
950759015 3:15203918-15203940 AATCTGCATATAATTACATATGG - Intergenic
951186067 3:19714487-19714509 AATTTCCATATCAATAAATGGGG - Intergenic
951400550 3:22227806-22227828 AATTTACATATAATTAAAGTAGG + Intronic
951670763 3:25179299-25179321 AATCTGCATATACTTAAAACAGG - Intronic
952236212 3:31482649-31482671 AACTTGCATATGATTCAAAGGGG - Intergenic
952456882 3:33481143-33481165 AAGTTGGCTATAATTAGAAGGGG - Intergenic
952564455 3:34638201-34638223 AATTTGCATGTAGTTAAAAGTGG - Intergenic
952829030 3:37547969-37547991 TATTTGCATAAAATAAAAGGAGG - Intronic
953275074 3:41487273-41487295 AATTGGCATATAATTAATATTGG + Intronic
953408189 3:42670676-42670698 AATTTGCATGTAAGTCAAAGTGG - Intergenic
954021184 3:47743399-47743421 AGTTTCCTTAAAATTAAAAGTGG - Intronic
954163084 3:48735569-48735591 AATCTGCATGCAATTAAAAGTGG - Intronic
954803501 3:53201365-53201387 AATTTGCATATAATTAAAAGTGG + Intergenic
954846472 3:53563006-53563028 AATTTGCCTATATTTAAAGATGG + Intronic
956401167 3:68881720-68881742 CATTTGCATATATTAAACAGGGG - Intronic
956484907 3:69711746-69711768 AATTTGCATATAATTAAAAGTGG + Intergenic
956489983 3:69760512-69760534 GATTTGCATGTAATTCCAAGTGG - Intronic
956839256 3:73121816-73121838 AGTTTGCATATAAATAAAGTAGG - Intergenic
957056263 3:75445147-75445169 AATCTGCATACAATTAAAAGTGG - Intergenic
957165313 3:76664795-76664817 AAGTGAAATATAATTAAAAGTGG + Intronic
957378191 3:79388296-79388318 TTTTTTCATATAATTAAAAAGGG + Intronic
957415352 3:79895164-79895186 CATTTGCATGTAATTAAAAGTGG + Intergenic
957705679 3:83779235-83779257 ATTTTTAATATAAGTAAAAGTGG - Intergenic
957752600 3:84441218-84441240 AATTTGCATATCATTCTATGTGG - Intergenic
957784069 3:84857908-84857930 AAGTTATATAAAATTAAAAGTGG + Intergenic
958150256 3:89684130-89684152 AATTTGCATCTTACTGAAAGGGG + Intergenic
958181496 3:90066087-90066109 AATTTGCAATTAATTAAGACAGG + Intergenic
959061905 3:101623733-101623755 AATTTCCATATAATTAAAAGTGG - Intergenic
959266224 3:104142298-104142320 AATTTGCATTTGATTAAAAGGGG + Intergenic
959333041 3:105030602-105030624 AATTTGCATATAATTAAAAGTGG + Intergenic
959357311 3:105348633-105348655 CATTTGCATAAAATTAAAAAGGG - Intergenic
959458330 3:106591765-106591787 AATTTGCATATAATTAAAAATGG + Intergenic
959717989 3:109454551-109454573 CATTTATAAATAATTAAAAGAGG + Intergenic
959770631 3:110090885-110090907 AATTTGCATGTAATGGTAAGTGG - Intergenic
959780541 3:110227627-110227649 AATTTGCATGTAATTAAAAGTGG + Intergenic
960757973 3:121038985-121039007 TATTTGTATATATTTAAAGGAGG + Intronic
961298124 3:125903560-125903582 AATCTGCATGCAATTAAAAGTGG + Intergenic
961503572 3:127355281-127355303 AATTTGCATGTAATTAAAAGTGG - Intergenic
961527233 3:127512904-127512926 AATTTGCATGTAATTAAACATGG + Intergenic
961744941 3:129058686-129058708 AATTTGCATGTAATGAATAGTGG + Intergenic
961864019 3:129940450-129940472 ATTTAGCGTATAATTAAGAGAGG + Intergenic
962173036 3:133122969-133122991 AATTTGCAGAGACTTAACAGTGG - Intronic
962336955 3:134542207-134542229 TATATACATATAATTAACAGTGG - Intronic
962519705 3:136186896-136186918 AATCTGCAGATGATTTAAAGCGG - Intronic
962662264 3:137615199-137615221 AATTTGCCTATAATTACTATAGG + Intergenic
962697396 3:137963620-137963642 AATTTGCATGAAATTAAAGGTGG - Intergenic
963474289 3:145783778-145783800 AATTTACATAAAAATAACAGTGG - Intergenic
963706382 3:148693194-148693216 AATTTTCATTAAATTAAAAATGG - Intergenic
963790722 3:149579695-149579717 AGTTTGCTTATACTTAAATGGGG - Intronic
963843213 3:150129227-150129249 AATGTGCATACAAATTAAAGGGG - Intergenic
963974147 3:151461456-151461478 AATTTACTTATTTTTAAAAGAGG - Intergenic
964006875 3:151840830-151840852 GATTTGCATATAATCTATAGAGG - Intergenic
964100892 3:152987100-152987122 ATTTTACATATAATAAATAGGGG - Intergenic
964197297 3:154079518-154079540 AATTTGCACATAATTAAAAGTGG - Intergenic
964785430 3:160391034-160391056 AATTTGCATATAGCTAAAAGTGG + Intronic
964978092 3:162643819-162643841 AATTTTCATATAATTAAAATTGG - Intergenic
965326322 3:167309098-167309120 AATTTGCATGTAATTAAAAGTGG + Intronic
965969878 3:174542027-174542049 AATTTGCACAGAATTAAAAATGG - Intronic
966072566 3:175896452-175896474 AATTTGCATATAATTTAAAGTGG + Intergenic
966525081 3:180911894-180911916 AATTTGCATGCATTTAACAGAGG + Intronic
967227389 3:187305024-187305046 ACTTGGCATATAATTTCAAGAGG + Intergenic
967377131 3:188817040-188817062 TATTTGCAAATAATTAAGATGGG + Intronic
967576703 3:191103220-191103242 ATTTTGCATTTAAATAAAACAGG + Intergenic
967620498 3:191627942-191627964 AATTTGTATGTAATTAAAAGTGG + Intergenic
967843605 3:194027265-194027287 AATTTGCATATAGTTAAAGGTGG - Intergenic
968600118 4:1504709-1504731 AATTTGCATATCATTAAAAGTGG - Intergenic
969031225 4:4216249-4216271 AATTTGCATATAAAAAAGACTGG + Intronic
969191522 4:5524919-5524941 AATTAGCATATAATTAAAAGTGG - Intronic
969218463 4:5742988-5743010 CATTTGCATGTAATTGAAAGTGG - Intronic
969356836 4:6632924-6632946 AATTTTCACATAATTAAAAGTGG - Intergenic
969359104 4:6650177-6650199 AATTTGCATGTAATTAAAAGTGG + Intergenic
969698915 4:8754974-8754996 AATTTGCATATAATTAAAGCTGG + Intergenic
969754927 4:9143206-9143228 AATCTGCATGCAATTAAAAGTGG + Intergenic
969814829 4:9679489-9679511 AATCTGCATGCAATTAAAAGTGG + Intergenic
969882104 4:10183193-10183215 GATTTGCATATAGTAAAAGGGGG - Intergenic
970073210 4:12186838-12186860 AATTTGCATGCAATTAAAAGTGG - Intergenic
970232879 4:13928750-13928772 AATTTGAATGTAATCAAAAAAGG + Intergenic
970286595 4:14523786-14523808 AAATTGTATATAATTCAAAAAGG + Intergenic
970457703 4:16241556-16241578 CATATGCATATATATAAAAGTGG + Intergenic
970734473 4:19149912-19149934 ATATAGCATATAATTAAGAGTGG + Intergenic
971466137 4:26963762-26963784 AATTTTCATAGAAATAAGAGAGG + Intronic
971527983 4:27645770-27645792 AATTTCAATATGATTAAGAGAGG + Intergenic
971602858 4:28617888-28617910 AATTTGCATGTGATTTATAGAGG + Intergenic
971722453 4:30263651-30263673 ACATTGGATATAATGAAAAGTGG - Intergenic
972163982 4:36260172-36260194 AATTTGCTCAAAATCAAAAGGGG + Intergenic
972413017 4:38811618-38811640 AATCTGCATGCAATTAAAAGTGG + Intronic
972737642 4:41860185-41860207 ATTTTGTATATATTTAAATGAGG - Intergenic
972864400 4:43212663-43212685 AATATGCACATAAGTAGAAGTGG + Intergenic
972906359 4:43752667-43752689 AATTTACAAAGAAATAAAAGAGG - Intergenic
972942317 4:44211762-44211784 AACTTACATATAATTAAAAGAGG + Intronic
972984092 4:44742632-44742654 GATTTGCAGATAATTTAATGTGG - Intergenic
973148514 4:46859839-46859861 AATTTGCATGTAATTAAAAGTGG + Intronic
973149335 4:46867548-46867570 AATTTGCGTGTAATTAATAGTGG + Intronic
973676929 4:53273542-53273564 AAATGGCATAAAATTGAAAGAGG + Intronic
973877725 4:55237479-55237501 AATCTGTCTATAATTGAAAGTGG + Intergenic
974022136 4:56701109-56701131 AATTAGCATATAATGAGCAGTGG - Intergenic
974278387 4:59757871-59757893 AATTAGCATATACGGAAAAGGGG + Intergenic
974522290 4:62997715-62997737 AATTTGCCTATTGTTGAAAGTGG - Intergenic
974651603 4:64760259-64760281 AATTTGAAGATAATTTAATGAGG - Intergenic
974806491 4:66887234-66887256 AATTTGCATAAAAATAGAACTGG + Intergenic
974866807 4:67591135-67591157 AATTTGCAGAAAAAGAAAAGTGG - Intronic
975823397 4:78294325-78294347 AATAGGCATTTAATTAACAGGGG + Intronic
975909947 4:79255853-79255875 AATCTGCATGCCATTAAAAGTGG - Intronic
975966310 4:79976561-79976583 AATTTTCATATAATTAAAAGTGG + Intronic
975987645 4:80217475-80217497 ATTTTATATATATTTAAAAGAGG - Intergenic
976915363 4:90367422-90367444 AATTTGTATGTAATTAGTAGTGG + Intronic
977147735 4:93466501-93466523 AATCTGCATGCAGTTAAAAGTGG - Intronic
977157072 4:93587892-93587914 ATTTTGCATATTATTAAAAGCGG + Intronic
977825274 4:101523947-101523969 AATTTGTATGTGATTGAAAGTGG + Intronic
977843402 4:101738541-101738563 AATTTGAATATAACTCAAATTGG - Intronic
977889116 4:102287230-102287252 ATTTTGCATACAATTTAAAGGGG - Intronic
979211342 4:118107615-118107637 CATTTGTATAAAAATAAAAGAGG + Intronic
979311385 4:119208212-119208234 AATTTTCTTATCATTAAAATTGG - Intronic
979340667 4:119519469-119519491 AATCTGCAGGGAATTAAAAGAGG - Intronic
979472756 4:121120868-121120890 AATTTTAATATATTTTAAAGTGG - Intergenic
979647892 4:123093304-123093326 AATTTGCATGTAAATGAAAGTGG - Intronic
979909893 4:126350344-126350366 AATTTTCATTAAATTTAAAGAGG - Intergenic
980132030 4:128825812-128825834 AATCTGCATATAATCTAAATAGG + Intronic
980334919 4:131459820-131459842 AATTAGCATATACTTAAAAGAGG + Intergenic
980434762 4:132756446-132756468 AATTTGCATATAATTAAAAGTGG - Intergenic
981116363 4:140995401-140995423 AGTTTGTATATAACTAAAAGTGG - Intronic
981139054 4:141246769-141246791 AATTTGCATCATATAAAAAGAGG - Intergenic
981159652 4:141482540-141482562 ATTTTACATATATTTAAAAAGGG - Intergenic
981303140 4:143213435-143213457 AATTTTCTTTTAATTAAAACAGG + Intronic
981304682 4:143234248-143234270 AATTTAAATATAACTAAAATTGG - Intergenic
981333072 4:143535197-143535219 AATTGGGATTTAATTAAACGGGG + Intronic
981881971 4:149625066-149625088 ATTATCTATATAATTAAAAGGGG + Intergenic
981916525 4:150039902-150039924 AATTAGCATGTCATTAAAAGTGG - Intergenic
982319734 4:154065637-154065659 AATTTCCATTAGATTAAAAGTGG - Intergenic
982371896 4:154642741-154642763 AATTTGCATGTAATTGACATTGG + Intronic
982416280 4:155136337-155136359 TATTTGTTTATAATTAAACGAGG + Intergenic
982746508 4:159109041-159109063 AAGTTGCATAAAATTATAATGGG + Intronic
983337186 4:166411993-166412015 AATTAGTATATAATTTAAAATGG - Intergenic
983550582 4:169013317-169013339 AATCTGCAACTAATTATAAGGGG + Intergenic
983680804 4:170351532-170351554 AATCTGCATGCAATTAAGAGTGG - Intergenic
983706998 4:170674002-170674024 ATTTTGCATATAGTAAATAGTGG + Intergenic
983716000 4:170782073-170782095 AATTTGTAAATGATTAAAAATGG + Intergenic
983782485 4:171687995-171688017 AATTTGCATGAAATTAAAAGTGG + Intergenic
984274817 4:177597095-177597117 AATTTGCATGTAGTTAAAAGTGG - Intergenic
984365642 4:178795989-178796011 AATATGCATATGATGTAAAGAGG + Intergenic
984444766 4:179822812-179822834 AATTTGCACTTAATTCAAATAGG + Intergenic
984762284 4:183373006-183373028 CATTTGCAAGTAGTTAAAAGGGG - Intergenic
985148824 4:186923972-186923994 AATTTACTTACAATTTAAAGTGG - Intergenic
985690902 5:1311728-1311750 AGTCTACATGTAATTAAAAGTGG - Intergenic
985700469 5:1368866-1368888 AAGTTGCACGTAATTGAAAGCGG + Intergenic
986100061 5:4599916-4599938 AATTTCCACATATTTAAAATTGG - Intergenic
986103298 5:4633867-4633889 ACTTTACATATAATTAAACACGG - Intergenic
986201805 5:5586031-5586053 AATTTGCAGGTAATTGAAAGTGG - Intergenic
986785774 5:11112662-11112684 AATGTTCATATCATTAACAGTGG + Intronic
986793180 5:11183073-11183095 AATTTGAATCTAATGAAAATGGG - Intronic
987163204 5:15166639-15166661 AGTTTGTATATAATTAAAAGTGG + Intergenic
987197729 5:15544050-15544072 AATTTGCATGTAATTAAAAGTGG + Intronic
987496939 5:18658245-18658267 AATCTGCATGCAATTAAAAGTGG - Intergenic
987582579 5:19813840-19813862 AATTTTCATATTATCAAATGTGG + Intronic
987740114 5:21896405-21896427 AGTTTACATATAATGAAAAGAGG - Intronic
987753290 5:22068496-22068518 ATTTTGCATAGAATTAGAAATGG + Intronic
987832407 5:23112310-23112332 ATTTTGCATATCATTAGAAGAGG + Intergenic
987866649 5:23549391-23549413 AATTTGCTTATAATCAAATAAGG - Intergenic
987872406 5:23637886-23637908 TATCTGGAGATAATTAAAAGTGG + Intergenic
988225527 5:28407467-28407489 AATTTGCATATATTTGAAAGTGG - Intergenic
988418829 5:30980266-30980288 AATATATATATAATCAAAAGTGG + Intergenic
988910316 5:35834138-35834160 AATTTTCAAATAATGAAAATGGG - Intergenic
988936635 5:36090033-36090055 AATTTGCATGTAATTGAAAGTGG - Intergenic
989311322 5:40022095-40022117 AGTTTGCATGCAATTGAAAGTGG - Intergenic
989785437 5:45322249-45322271 TATTTGCATATAATTTCAATGGG - Intronic
990307444 5:54507050-54507072 AATATACATATAATGAAATGGGG + Intergenic
990616006 5:57508970-57508992 AATTTGCATATAATTAAAAGTGG + Intergenic
990620431 5:57553373-57553395 AATTTGCAAATAATAATAAATGG + Intergenic
990688157 5:58331679-58331701 AATTTCAAAATAATTAAAATGGG + Intergenic
991004360 5:61813143-61813165 AGTTGGCATGAAATTAAAAGTGG - Intergenic
991068077 5:62445362-62445384 AACATGCATAAAATTAAAGGTGG + Intronic
991315741 5:65303830-65303852 AAACTGCATATACTTAAGAGAGG + Intronic
991590227 5:68243484-68243506 AAGTTGCAGTGAATTAAAAGAGG + Intronic
991689952 5:69216344-69216366 CATTTGAAAATAATTAAAATGGG + Intergenic
991944423 5:71885733-71885755 AATTTGCATGTAATTAAAAGTGG - Intergenic
992354428 5:75966611-75966633 AATTTGCATGTAATTAAAAGTGG + Intergenic
992544379 5:77797010-77797032 AATTTGCATTTTATTTAAAGTGG - Intronic
993010792 5:82480173-82480195 ACTATGCAGATAATTAAAACAGG + Intergenic
993154015 5:84198722-84198744 AATTTGTATATTATGAAATGGGG + Intronic
993298473 5:86175485-86175507 AATTTGCATATAACTAAAAGTGG + Intergenic
993326843 5:86550217-86550239 TGTTTCCATATAATTAACAGTGG - Intergenic
993462818 5:88205662-88205684 AACTTGCTTATAGTTGAAAGAGG + Intronic
993471727 5:88314741-88314763 AATTTGCATTTTTTTAAAAAAGG - Intergenic
993480088 5:88414191-88414213 AATTTACATAACAATAAAAGAGG + Intergenic
993828052 5:92717875-92717897 AATTTGCATATAATGAAACTAGG - Intergenic
993913728 5:93715167-93715189 AATGTATATATAATCAAAAGAGG + Intronic
993976817 5:94493040-94493062 GTTTTGCATATAATTCCAAGAGG + Intronic
994223546 5:97225275-97225297 TTTTTACATATAATTAAAAATGG + Intergenic
994238289 5:97391313-97391335 AATTTGCATGTAATTGAAAGTGG + Intergenic
994238802 5:97395779-97395801 AATTTACACATAATTATAAGTGG + Intergenic
994599383 5:101882956-101882978 AAATTACACATAATTAAATGAGG + Intergenic
994750832 5:103734872-103734894 AACTTGCAGATAATTTAGAGTGG + Intergenic
994801289 5:104380429-104380451 AATTTGCATATAATTAAAAGTGG + Intergenic
994900682 5:105764751-105764773 AATCTACATATTATTAAAAGTGG + Intergenic
994905527 5:105837761-105837783 AATTTGCATAAAATTAAAAGTGG + Intergenic
994971942 5:106750556-106750578 AATTTGTATATCATAAAAAAAGG + Intergenic
995199841 5:109413603-109413625 AATTAGCATATAATTAAAAGTGG - Intergenic
995303989 5:110621911-110621933 AATTTGCATAAAATCTAAACTGG - Intronic
995370474 5:111412893-111412915 AATTTATATGTAATTAAAAGTGG + Intronic
995840191 5:116436651-116436673 AATCTGCATGCAATTACAAGTGG + Intergenic
995901930 5:117079770-117079792 ATTTTGCATTTAATTAAGAGTGG + Intergenic
996139167 5:119884295-119884317 AATTTACAAATACTTAAATGTGG - Intergenic
996329696 5:122314591-122314613 AATCTGCATATAAATCAAATGGG - Intronic
997065231 5:130551731-130551753 AATTTGCATATAATTAGAAGTGG + Intergenic
997065372 5:130553537-130553559 AATTTGCATGCAATTGAAAGTGG + Intergenic
997065452 5:130554212-130554234 AATTTGCCTGTAAGTGAAAGTGG + Intergenic
997070565 5:130617639-130617661 AATCTGCATGTAGTTAAAAGTGG + Intergenic
997073873 5:130648668-130648690 AATTAGTACATAATTAAAAGTGG - Intergenic
997191240 5:131937975-131937997 AATTTTCCTAGAATTAAAAATGG - Intronic
998579842 5:143361289-143361311 AATTTTAATAAAATTAAAAAAGG + Intronic
998657374 5:144196599-144196621 ATTTTTCATATATTTAAATGAGG - Intronic
999012477 5:148057857-148057879 TATTTGGAGATAAGTAAAAGTGG - Intronic
999034600 5:148333500-148333522 AATTTGCATATAATTAAAAGTGG - Intronic
999674689 5:153987290-153987312 AATTTGCAGGTAATTAAAAATGG - Intergenic
1000116356 5:158157439-158157461 AATTTGCATATACTAAAACAAGG - Intergenic
1000593449 5:163186274-163186296 AATTTGCATGTAATTGAAAGTGG + Intergenic
1000636205 5:163646393-163646415 AAGTTAAAAATAATTAAAAGTGG - Intergenic
1000646505 5:163766371-163766393 AATTTGCATATAATCAAAAGTGG - Intergenic
1000728896 5:164806044-164806066 AATTTGCACGTAATTAGAAGTGG - Intergenic
1000728924 5:164806279-164806301 AATATACATATTAATAAAAGAGG - Intergenic
1001437483 5:171711595-171711617 AATTTGCATATAAATAAAAGTGG - Intergenic
1002463931 5:179394508-179394530 AATTTGTGTATAATTAAAACTGG + Intergenic
1003043812 6:2714362-2714384 AATTTGCATGTAATTGAAAGTGG + Intronic
1003208966 6:4042023-4042045 TATTTGCATATAATCTGAAGGGG - Intronic
1003652491 6:7974372-7974394 AGTCTGTATATAATTAAAAGTGG - Intronic
1003761030 6:9178970-9178992 ACTTTGCAAATAATAAAATGAGG + Intergenic
1003787347 6:9501410-9501432 AATTAGCGTGTCATTAAAAGTGG + Intergenic
1004083452 6:12419967-12419989 AAGTTGCTTATATTTTAAAGAGG + Intergenic
1004232218 6:13843752-13843774 AATCTGCATGCAATTAAAAGTGG + Intergenic
1005390930 6:25332478-25332500 AATTTGCTGATGATCAAAAGTGG + Intronic
1005567931 6:27115174-27115196 AATTAGCATATAATTAATAGTGG - Intergenic
1005794488 6:29344171-29344193 AGTTTTCATACAATTAAAAATGG - Intergenic
1006199625 6:32276593-32276615 GATTGGCATATGATTGAAAGTGG - Intergenic
1006417739 6:33914645-33914667 AATTGGCATGTGATCAAAAGTGG + Intergenic
1006722097 6:36162148-36162170 AATTTGCATGTACTTTAAAGTGG + Intergenic
1006746475 6:36346345-36346367 AATTTGCATATAATGCAAGCGGG + Intergenic
1007286702 6:40753057-40753079 AATTTGCACATCTTTAAAATGGG + Intergenic
1007366156 6:41395121-41395143 AATTGAGATGTAATTAAAAGAGG + Intergenic
1007553762 6:42749157-42749179 AATTTTCAAAAAGTTAAAAGGGG - Intronic
1007580734 6:42958203-42958225 AATTGACTTATAAGTAAAAGAGG - Intergenic
1007945367 6:45821860-45821882 AATTTCCATTTTTTTAAAAGAGG + Intergenic
1008191338 6:48462207-48462229 AATATGCATTTAATTAAGAATGG + Intergenic
1008206915 6:48671540-48671562 AATTTGCATGTTATTGAAAGTGG - Intergenic
1008326691 6:50190636-50190658 AATTTGACTATATTTAAAAATGG - Intergenic
1008579802 6:52896676-52896698 AATTAGCATATAATTGGAAAGGG + Exonic
1008794951 6:55291861-55291883 AATTTTCAAATACTTAAAGGAGG - Intergenic
1009315864 6:62220519-62220541 AATTGGCATATAATCTTAAGAGG + Intronic
1009370474 6:62894350-62894372 AATTTGCATGTAATTGAAAGTGG - Intergenic
1009525677 6:64741958-64741980 TATTTGAAGAAAATTAAAAGTGG - Intronic
1009757035 6:67953525-67953547 AATTTGCATATAATCAGAAATGG - Intergenic
1009833606 6:68970100-68970122 AAGTGACATATAATTAAAACTGG - Intronic
1010041121 6:71385173-71385195 AGTTTGCTTCTCATTAAAAGTGG + Intergenic
1010042688 6:71405151-71405173 AATTTACAGTTATTTAAAAGTGG - Intergenic
1010675919 6:78742778-78742800 AATTTGCATGCAATTGTAAGTGG + Intergenic
1010808873 6:80274644-80274666 CAATTGCATATAATTAAAAAAGG + Intronic
1010866611 6:80983363-80983385 ACTTTATATGTAATTAAAAGTGG + Intergenic
1011178600 6:84593097-84593119 AATTTGCATATAATTAAAAGTGG - Intergenic
1011545400 6:88477412-88477434 AATTTACATATAATTGAAAGTGG - Intergenic
1011604415 6:89088515-89088537 AAGCTGCATTTAATTAGAAGAGG + Intergenic
1011830012 6:91360390-91360412 AATTTTCATGTAAGTAAAATGGG - Intergenic
1011903899 6:92336329-92336351 AATTTCCATATCAGTAACAGAGG - Intergenic
1012243740 6:96902784-96902806 AATATGCAGAAAATTAAAACTGG - Intergenic
1012371831 6:98516674-98516696 AATGTACACATATTTAAAAGAGG - Intergenic
1012570793 6:100725403-100725425 AATCTTCATATTTTTAAAAGGGG - Intronic
1012665977 6:101970493-101970515 AATTTTCATATAATAAAAAGTGG - Intronic
1012713823 6:102643667-102643689 AATATGAATAAAATAAAAAGAGG + Intergenic
1012772357 6:103454970-103454992 AACTTGCATGTAATTAAAAGCGG + Intergenic
1012895607 6:104942543-104942565 AATTTGCATAGATTTTATAGAGG + Intergenic
1013420681 6:109963897-109963919 ATTTTGCATGTAATTAAAAGTGG + Intergenic
1013509374 6:110830557-110830579 AATTTGCATGTGATTAAAACTGG + Intronic
1013679440 6:112508091-112508113 AATTTGAATAAAAATATAAGTGG - Intergenic
1013708268 6:112865374-112865396 AATTAGCATGTCATTAAAAGTGG - Intergenic
1013926927 6:115484161-115484183 AATTTTTATATTATTAAATGTGG + Intergenic
1014533186 6:122585039-122585061 AATTTGCATATAATTAAAAGTGG + Intronic
1014592993 6:123295254-123295276 AATATGCATGCAATTAAAAGTGG + Intronic
1014695167 6:124611655-124611677 AATCTGTCTATAATTTAAAGTGG - Intronic
1014781359 6:125568591-125568613 AATTTGCATATGATAAAATTAGG + Intergenic
1014916805 6:127160576-127160598 AATTTGCATCTAATTAAAAGTGG - Intronic
1014934173 6:127366712-127366734 AATTTTAATATAATTAACAGTGG - Intergenic
1015217175 6:130763455-130763477 GATTTGCATATAAACACAAGTGG + Intergenic
1015253085 6:131147670-131147692 AATTTGGATATAAATAAAGAAGG + Intronic
1015253499 6:131152014-131152036 AATTTACATAAAATTACACGTGG + Intronic
1015949750 6:138540149-138540171 AAATTGCATATAATTGTTAGTGG - Intronic
1016027694 6:139304837-139304859 AATTTGCATTTATAGAAAAGTGG - Intergenic
1016053696 6:139556407-139556429 ATTTTGCATCTAATTCATAGTGG + Intergenic
1016548059 6:145246361-145246383 AATTTGCATATAATTAAAAGTGG + Intergenic
1017053252 6:150413915-150413937 AATCTGTATGTAATGAAAAGTGG - Intergenic
1017377538 6:153788310-153788332 AATTAGAAGATAATGAAAAGAGG - Intergenic
1017385511 6:153878341-153878363 AGTTTGCATGAAATTAAAAGTGG - Intergenic
1017736489 6:157369520-157369542 AATCTGCATGTAATTAAAAGTGG + Intergenic
1018029701 6:159832131-159832153 AATTCATGTATAATTAAAAGTGG + Intergenic
1018080237 6:160253296-160253318 AATTTGCATATAATTAAACGTGG - Intronic
1018195290 6:161350536-161350558 TATTTGAATATATTTAAATGAGG - Intronic
1018415623 6:163600024-163600046 AATTTGCATGTAATTAAAGTGGG + Intergenic
1018520545 6:164645366-164645388 CATTTGTATATAATCAAGAGTGG + Intergenic
1018536367 6:164824918-164824940 AATTTGCATGTGATTAAAAGTGG + Intergenic
1019029083 6:168995021-168995043 AACTTGCATGTAATTAAAAGTGG - Intergenic
1019096015 6:169579719-169579741 ATGTAGCATATAATTAAGAGTGG + Intronic
1019156584 6:170043302-170043324 AATTCGCAGATTATGAAAAGGGG - Intergenic
1019265236 7:111723-111745 AATTTACATACAATTTAAATTGG - Intergenic
1019355747 7:577935-577957 AATGTGCACATAATTTAAAGTGG - Intronic
1019954331 7:4401407-4401429 AATTTGCAGGTAATTAAAAGTGG - Intergenic
1020769577 7:12371559-12371581 AATTTTAAGAAAATTAAAAGGGG - Intronic
1020776822 7:12464665-12464687 AATTTTCATATAAGTAAAACTGG + Intergenic
1020782034 7:12529926-12529948 AATTTGCATGTAGTTAAAAGTGG - Intergenic
1020856785 7:13437088-13437110 GATTTGTATGTAATTAAAATTGG - Intergenic
1021313916 7:19122632-19122654 AATTTGCATTAAAATATAAGTGG - Intergenic
1021650430 7:22827826-22827848 AATTTGCATATAATTAAAACTGG + Intergenic
1021896479 7:25240777-25240799 AATTTGCACAGAAGTAAAACGGG + Intergenic
1022007663 7:26281022-26281044 AATTTGCATGTAATTAAAAGTGG + Intergenic
1022299470 7:29089703-29089725 AATCTGCATGTAATTAAAAGTGG + Intronic
1022624086 7:32016084-32016106 AATTTGTATATAGTTAAAGGTGG + Intronic
1022687805 7:32612929-32612951 AATTTGCGTATAATTAAAAGTGG - Intergenic
1024187708 7:46970106-46970128 AATTTGCATGTAATTAAAAGTGG - Intergenic
1024405655 7:48976378-48976400 AATCTGCACGTTATTAAAAGTGG - Intergenic
1024435039 7:49342203-49342225 AATTAGCATATAAGTAAAAGTGG + Intergenic
1024435950 7:49354773-49354795 AATTTGCACATAATTAAATATGG - Intergenic
1024652687 7:51419165-51419187 AATTAGCATCTAATTAAGAGTGG - Intergenic
1025037867 7:55609804-55609826 AATTAGCATCTAATTAAGAGTGG - Intergenic
1025164554 7:56701429-56701451 AATTTGTGTGTAATTAAAATTGG + Intergenic
1026128053 7:67596895-67596917 CATTTGAATGTAATTAAAAGGGG - Intergenic
1026357312 7:69569866-69569888 AATTTGCATGTAATTAAAAGTGG - Intergenic
1026372836 7:69718826-69718848 ATTTTGCAAAGAATTAATAGAGG - Intronic
1026535103 7:71232740-71232762 AATTTGCGTGTAATTAAAAGTGG - Intronic
1026664696 7:72332275-72332297 AATTTGCCTGTAACTAAAAGTGG - Intronic
1026674301 7:72416256-72416278 AATTTGCATATAATTAGAAGTGG + Intronic
1026877729 7:73889178-73889200 AATTTGCATATAATTGAAAGTGG + Intergenic
1027127383 7:75566440-75566462 AATTTACATATAATTAAAAGTGG - Intronic
1027337986 7:77174474-77174496 AATTTGCATCTAATTAAAAGTGG - Intronic
1027797194 7:82710504-82710526 AATTTGCATGTAATTAAAAGTGG - Intergenic
1027822649 7:83067337-83067359 AATATGGATAAAATTAATAGTGG - Intronic
1028075064 7:86502498-86502520 AATCTGCATGCAATTAAAAGTGG - Intergenic
1028275375 7:88849783-88849805 AATTTTCATATATTTAAATGAGG - Intronic
1028317903 7:89427039-89427061 AATTTGCACATAATTGAAAGTGG - Intergenic
1028383381 7:90224396-90224418 AATTTGCATATAAATCAAGTAGG + Intronic
1028672152 7:93414134-93414156 AATATGCATATATTTTAGAGTGG + Intergenic
1028715546 7:93962892-93962914 ATCTTGGCTATAATTAAAAGTGG + Intronic
1028883455 7:95906118-95906140 ATTTTACATATAATTGAAAAGGG - Intronic
1028934099 7:96446222-96446244 ATTTTGGACATCATTAAAAGAGG - Intergenic
1029094267 7:98072679-98072701 TATTTGCATATAGGTAAAAGTGG - Intergenic
1029161209 7:98553432-98553454 AATTTGCAGGTAATCAAAAGTGG + Intergenic
1029188126 7:98754064-98754086 AATTTGCATATAATTAAAAGTGG - Intergenic
1029197765 7:98818321-98818343 AATTTGCCTATAATTAAACGTGG - Intergenic
1029427655 7:100506617-100506639 AATTTGCATATAATTAAAAATGG - Intergenic
1029576668 7:101407910-101407932 AATTTGCATACCATTAAGATGGG + Intronic
1029577376 7:101412341-101412363 AATTTGCATACAATTAAAAGTGG + Intronic
1029601958 7:101571047-101571069 AATTTGCCTAAAATTTAAAAAGG - Intergenic
1029777748 7:102696337-102696359 AATTTGCATCTAATTAAAAGTGG + Intergenic
1029817929 7:103115809-103115831 AATTTACATATAATTAAAAGTGG - Intronic
1030221348 7:107102371-107102393 ATTTAGCATATAATTAAGAGTGG + Intronic
1030222212 7:107109034-107109056 ATTTAGCATGTAATTAAAAGTGG - Intronic
1030425069 7:109366117-109366139 ATTTTGTATATAATAAAAATTGG - Intergenic
1030425206 7:109368106-109368128 TATTTACATATATTTTAAAGAGG + Intergenic
1030542588 7:110850443-110850465 GATTTACATATAACTGAAAGTGG + Intronic
1030605550 7:111635512-111635534 AATTTGTATGTAACCAAAAGGGG + Intergenic
1030776768 7:113543333-113543355 AATTTGCATATAATTGAAAGTGG + Intergenic
1030900863 7:115121392-115121414 AATTTACATGTAATTTAAAGTGG + Intergenic
1030931537 7:115529247-115529269 AATTTGGATATCAATAATAGTGG - Intergenic
1031325793 7:120395631-120395653 ACTTAGCATATAATTAGAAGTGG - Intronic
1031366696 7:120909136-120909158 AATTTGAATGTCATTAATAGAGG - Intergenic
1031383838 7:121121265-121121287 AATTTTCAATTAATTAAAAATGG - Intronic
1031623736 7:123968233-123968255 AGTTTGCGTATAATTATAAGTGG - Intronic
1031668131 7:124510824-124510846 AATTTGCTTGTAACTGAAAGTGG - Intergenic
1031805415 7:126301467-126301489 AATTAGCATATAATTAAGAGTGG + Intergenic
1031805882 7:126305358-126305380 AATTGGCTTATAACTAAGAGTGG + Intergenic
1031892328 7:127309138-127309160 AATTTGCATATAATTAAAAGGGG + Intergenic
1031910578 7:127512898-127512920 AATTTACATATTCTAAAAAGCGG + Intergenic
1032421788 7:131786294-131786316 AATTAACATATAATTAAAATAGG - Intergenic
1032432394 7:131872557-131872579 AATTTGCTTATATGTAAAATGGG + Intergenic
1032521483 7:132548901-132548923 AATTAGCATATAATGAGCAGTGG - Intronic
1032798427 7:135297840-135297862 TATCTGCATATATTTAAGAGTGG - Intergenic
1032871073 7:135986257-135986279 AAGTTGGCTATAATTAAAAAAGG - Intergenic
1032949925 7:136896047-136896069 TATTTGCATATAATGCAAAAAGG + Intronic
1032988488 7:137364386-137364408 AATTAACGTATGATTAAAAGTGG - Intergenic
1033847184 7:145447956-145447978 AATTTGCCTGTAATTTAAAGTGG + Intergenic
1033953744 7:146817498-146817520 AATTTATATAAAATAAAAAGAGG + Intronic
1034110001 7:148527627-148527649 AATTTGCATGTAATTAAAAGTGG - Intergenic
1034383995 7:150722760-150722782 AATTTGCATATAGTTGAAAGTGG - Exonic
1034707339 7:153157299-153157321 AATTTGCATGTAATTAAAAGTGG + Intergenic
1034743501 7:153500574-153500596 CATTTGCAGAAAATTAAAACTGG - Intergenic
1034970604 7:155417049-155417071 AATTTGCATATAATTAAAAGTGG + Intergenic
1034974013 7:155437444-155437466 AATTTGCATATAATTAAAAGTGG - Intergenic
1034985253 7:155509315-155509337 AAAGTGCATATATTTCAAAGTGG + Intronic
1035967515 8:4209819-4209841 ATTTTGCATGTAATTGAAAGTGG - Intronic
1035980038 8:4360270-4360292 AATTTGCTTTTACTTAATAGTGG + Intronic
1036137262 8:6173739-6173761 AATCTGCATGCTATTAAAAGTGG + Intergenic
1036237968 8:7058099-7058121 AATTTGAAAAAAATTAAATGAGG - Intergenic
1036378160 8:8218521-8218543 AATCTGCATGCAATTAAAAGTGG + Intergenic
1036913062 8:12775100-12775122 AATTAGCATATCATTGAAAGTGG + Intergenic
1037014389 8:13884202-13884224 AGTTTTCCTATCATTAAAAGGGG + Intergenic
1037053512 8:14406785-14406807 AATTTGAAAATAATTAAAAGTGG + Intronic
1037124850 8:15335500-15335522 AATATGCATATAATTAAAAGTGG + Intergenic
1037471466 8:19215443-19215465 AATTTACATATAATTGAAAGTGG + Intergenic
1037530681 8:19769815-19769837 AATTTGCATGTCATTAAAAGTGG + Intergenic
1037715997 8:21400784-21400806 AATTTGCATTTAATTAAAAGTGG - Intergenic
1038375201 8:27033138-27033160 TATTTGCATGCAATTGAAAGTGG - Intergenic
1038378269 8:27065122-27065144 AATTAGCACAGAATTCAAAGTGG + Intergenic
1038448986 8:27626796-27626818 AATTTGCATATAATTAAAAGTGG + Intergenic
1038490925 8:27970531-27970553 AATTTGCATATAATTAAAAATGG + Intronic
1038506508 8:28089546-28089568 AATTTGAATACAGTTAAAAGTGG - Intergenic
1038606188 8:29007384-29007406 AATTTGCATTTTCTTAGAAGAGG + Intronic
1038741359 8:30219725-30219747 AATATGGATACAGTTAAAAGTGG - Intergenic
1038787827 8:30637060-30637082 AATTTTATTATATTTAAAAGGGG - Intronic
1038835287 8:31113721-31113743 CATTTGCATAGGATTATAAGAGG - Intronic
1039157656 8:34579716-34579738 AATTTGCATATAATTCAAAGTGG + Intergenic
1039324989 8:36475198-36475220 AATTTGCATGTAATTAAAAGTGG - Intergenic
1039375287 8:37026671-37026693 AATTTGCATATAACTAAAACTGG + Intergenic
1039531983 8:38270787-38270809 AATTTACATGTAAGTAAAAAGGG - Exonic
1040011412 8:42664098-42664120 AATTTGGATGTCATTAAAAGTGG + Intergenic
1040018082 8:42716563-42716585 AATTTGCATATAATTAAAGGTGG - Intronic
1040353364 8:46590708-46590730 GATTTGGATATAATTAAATATGG - Intergenic
1040733910 8:50483100-50483122 AATTTTCATATAAGTAAAATGGG + Intronic
1040797486 8:51301873-51301895 AATTTTCATATAATAAAATGGGG + Intergenic
1040976413 8:53198579-53198601 AATTTTCATAGAATTAAAGTTGG - Intergenic
1041499404 8:58523627-58523649 AATTCGCATATAATTAAAAGTGG + Intergenic
1041607755 8:59803690-59803712 ATATTGCATATCATGAAAAGAGG + Intergenic
1041849706 8:62377131-62377153 AATTCGCATTTAATTAGAACTGG + Intronic
1041998675 8:64094351-64094373 AATTTTCATAAATCTAAAAGTGG + Intergenic
1042018462 8:64343562-64343584 ACTATGCAGATATTTAAAAGCGG + Intergenic
1042156654 8:65851378-65851400 AATTTGCATATAATTAAAAGTGG + Intergenic
1042518503 8:69684621-69684643 ATTTTGTATATAATTAATAGTGG + Intronic
1042746871 8:72118084-72118106 AATTTGCATGTAATAAAAATTGG + Intronic
1043021399 8:75005398-75005420 AATTTGGAAATAATTTAAATGGG + Intronic
1043131263 8:76464770-76464792 CATATGCATATTATTTAAAGAGG - Intergenic
1043169635 8:76949433-76949455 AAATTCCATAAAATTAAAAAGGG - Intergenic
1043654406 8:82643699-82643721 ATTTTGCATGTAATTAAAACTGG - Intergenic
1043735246 8:83732927-83732949 AAAATGCATATATTTAAAACTGG - Intergenic
1043754465 8:83985715-83985737 AATTAGCATATAACTAAGAGTGG - Intergenic
1043777785 8:84292098-84292120 ATTTTGGATATAATAAAATGTGG + Intronic
1043793007 8:84497492-84497514 ATTTGGCATATTATGAAAAGTGG - Intronic
1043855401 8:85259250-85259272 AATCTACACATATTTAAAAGTGG + Intronic
1044155685 8:88843590-88843612 AATTTGCATGTAATTAAAGTGGG - Intergenic
1044214372 8:89591165-89591187 AATATGCAAACAATAAAAAGTGG - Intergenic
1044244507 8:89926811-89926833 ATTTTTCTTAGAATTAAAAGTGG + Exonic
1044252422 8:90019482-90019504 AATTTGCAGGCAATTAAAAGTGG - Intronic
1044492982 8:92842610-92842632 AATTTGCATATAATTAAATGTGG - Intergenic
1044564806 8:93651531-93651553 AATTTGCATGTAATTAAAAGTGG - Intergenic
1044685410 8:94821699-94821721 AATCTGCATGCAATTAAAAGTGG + Intronic
1045010727 8:97956477-97956499 AATCTGCATGCAGTTAAAAGTGG - Intronic
1045126992 8:99103268-99103290 ATGTTGCATATAATTACAGGAGG + Intronic
1045757393 8:105560602-105560624 AATATACAAATAAATAAAAGAGG - Intronic
1045943492 8:107767315-107767337 ATTTTGCATTTAATTAAAAATGG - Intergenic
1046046835 8:108974694-108974716 GATTTACATATATTTCAAAGGGG + Intergenic
1046098129 8:109584248-109584270 GATTTGCATATAATTATATTTGG + Intronic
1046192341 8:110812817-110812839 AATTTACACATAATTTAAAAGGG - Intergenic
1046409624 8:113823395-113823417 AATTTCCTGATAATAAAAAGAGG - Intergenic
1046490067 8:114940023-114940045 AATTTTGAAATAGTTAAAAGAGG - Intergenic
1046829313 8:118726820-118726842 AATTTGCCAAGAATTAAAACTGG + Intergenic
1047173872 8:122521985-122522007 AATTTGCATGTAGATAGAAGAGG - Intergenic
1047240196 8:123080454-123080476 AATTTGCATACATTTACAAAGGG - Intronic
1047253118 8:123195478-123195500 AATGTTAATATCATTAAAAGTGG - Intronic
1047534155 8:125704023-125704045 AATTTGCTTGTTACTAAAAGTGG - Intergenic
1047559579 8:125972224-125972246 AATTAGCATAGAACTAAGAGTGG + Intergenic
1047942083 8:129836169-129836191 ATTTAGCATATAATTAAGAGTGG - Intergenic
1048105525 8:131404088-131404110 AATTAGCATATAGTCAAGAGTGG + Intergenic
1048742332 8:137575092-137575114 AATTTCCATATTATTAAAAGTGG - Intergenic
1048812236 8:138299184-138299206 AATTTTAATATAATTAAAATTGG - Intronic
1048812294 8:138299888-138299910 AATTTTAATATAATTAAAATTGG + Intronic
1048863956 8:138745656-138745678 AATCTGCAGAAAATTAAAATGGG + Intronic
1048938322 8:139375397-139375419 AATTAGCATGTCATTAAAAGTGG - Intergenic
1049027463 8:140004866-140004888 AATTAGCATAAAACTAAAACAGG + Intronic
1049253511 8:141601888-141601910 AATCTGCATGCAGTTAAAAGTGG + Intergenic
1049429644 8:142554603-142554625 AATTTGCATACGATTAAAAGTGG - Intergenic
1049627375 8:143631371-143631393 AATTTGCATATGATTAAAAGTGG - Intergenic
1049678623 8:143905011-143905033 AATTTGCATGTAAGTAAAAGTGG + Intergenic
1050154429 9:2650781-2650803 AACTTGCAGGTAATTAAATGAGG + Intronic
1050332549 9:4560204-4560226 AATTTGAAAATCATGAAAAGAGG + Intronic
1050620365 9:7445953-7445975 AATTTGCATGTAATTAAAAATGG - Intergenic
1050770636 9:9194791-9194813 ATTTTGCTTATTACTAAAAGGGG + Intronic
1050991896 9:12166592-12166614 ACTTTGCATGTAATCAAAAGTGG - Intergenic
1050993066 9:12176037-12176059 AATCTGCATGTAATTAAAAGTGG - Intergenic
1051011156 9:12416205-12416227 AATTTGCATGTAATTGAAAATGG - Intergenic
1051757281 9:20416568-20416590 TATATGCATGTAATTAAAAAAGG - Intronic
1051783317 9:20714164-20714186 TATTTGCATATACTTTAAACCGG + Intronic
1051948732 9:22604243-22604265 TATGTGCATTTAATTAAAATTGG - Intergenic
1052131646 9:24855619-24855641 AATTTGCACATAATTTAAAGTGG + Intergenic
1052565162 9:30140482-30140504 AATTAGCATATAATTAAGAGTGG + Intergenic
1052600571 9:30624205-30624227 CATATGCATATGATTAAAATTGG + Intergenic
1052618852 9:30879279-30879301 AATTTACATGGAATTAAAAGAGG - Intergenic
1052715801 9:32115472-32115494 AATTGGCTTATAATTATATGAGG + Intergenic
1052856679 9:33411232-33411254 AATCTGCATACAATTAAAAGTGG + Intergenic
1053125138 9:35574975-35574997 AATTTGCATGTAGTTAAAAGTGG + Intergenic
1053538957 9:38953923-38953945 AATTTGTATGTCATTCAAAGTGG + Intergenic
1054627183 9:67409996-67410018 AATTTGTATGTCATTCAAAGTGG - Intergenic
1055033793 9:71796635-71796657 GATTTGCATGTAATTTAAAGTGG + Intronic
1056444466 9:86652446-86652468 AATCTGCATGCAATTAAAAGTGG - Intergenic
1056618659 9:88191418-88191440 ATTTTGCATGTAATTAAAAGTGG - Intergenic
1057382274 9:94579573-94579595 AAGTTACCTATAATTAAAAGGGG + Intronic
1057714193 9:97476698-97476720 AATTTGCATACAATTCCAGGAGG - Intronic
1058108128 9:100998935-100998957 AATTTGCATACACAGAAAAGGGG - Intergenic
1058160579 9:101565919-101565941 AGTTTGGAAATACTTAAAAGTGG + Intergenic
1058194592 9:101956917-101956939 AATTAGCATGTCATTAAAAGTGG + Intergenic
1058199639 9:102023409-102023431 ATTTTGCATATGATATAAAGAGG + Intergenic
1058388974 9:104472768-104472790 AATTTTCATAAAATTAAATTAGG + Intergenic
1058431115 9:104920302-104920324 AATATGCATATAATTGTCAGTGG - Intronic
1058571797 9:106354198-106354220 AATATGCAGATGATTAAAACTGG - Intergenic
1058656930 9:107231094-107231116 AATTAGGTTATAATCAAAAGAGG - Intergenic
1059420560 9:114188192-114188214 AATTTGCATATAATTAAAGGTGG - Intronic
1059689309 9:116669243-116669265 AATTTGCATGTAATTAAAAGTGG + Intronic
1059978388 9:119742702-119742724 AATTTGCATATAATTAAAAGTGG + Intergenic
1059997415 9:119925527-119925549 AATCTGAAAATAATTAAAACTGG + Intergenic
1060226675 9:121795809-121795831 ACTTTGCATATTCTTAAATGAGG + Intergenic
1060702608 9:125771329-125771351 AATCTGCCTATAATTAAAACAGG - Intronic
1060709431 9:125843317-125843339 AATTTACATAAAATTTAAAAAGG + Intronic
1061223197 9:129264449-129264471 GATTTGGAAATAATTAAAAGTGG - Intergenic
1061224541 9:129273126-129273148 AATTTGCATATAATTAAAAGTGG + Intergenic
1061853131 9:133427813-133427835 AATTTGCATATAATTAGAAGTGG - Intronic
1062078735 9:134607286-134607308 GATTTGCATATAATTAAAATGGG - Intergenic
1062131231 9:134894493-134894515 AATTTGCATTTAGTTAAAAGTGG + Intergenic
1185562873 X:1073064-1073086 CATTTGCATGTAATTAGCAGCGG + Intergenic
1185682370 X:1899095-1899117 CATTTGCATGTAATTAGCAGTGG - Intergenic
1185803459 X:3034544-3034566 AATCTGCATGCAATTAAAAGTGG - Intergenic
1185811616 X:3115578-3115600 AATCTGCATGCAATTAAAAATGG + Intergenic
1185857601 X:3550482-3550504 AATTTGCATGCCATTAGAAGTGG + Intergenic
1186010414 X:5125438-5125460 AATTTGCATGTTATTAAGAGTGG + Intergenic
1186025914 X:5311624-5311646 AATTAGCATATAATTTATAAAGG - Intergenic
1186045694 X:5534211-5534233 AATCTGCATGTAATTAAAAGTGG + Intergenic
1186152256 X:6687830-6687852 AATTAGCATATAATGAGCAGTGG + Intergenic
1186160650 X:6773829-6773851 AATCTGCAGGAAATTAAAAGTGG + Intergenic
1186219165 X:7331236-7331258 AATTTTTACATAATTAAAAAGGG - Intronic
1186536873 X:10359158-10359180 AATTTGCATGTAATTAAAAGTGG - Intergenic
1186604116 X:11071071-11071093 ATTTTGCATATAATTAAAAGTGG + Intergenic
1186886770 X:13921882-13921904 AACCTCCATATTATTAAAAGTGG - Intronic
1187001853 X:15189198-15189220 AATCTGCATATAATTGATAACGG - Intergenic
1187045131 X:15640302-15640324 AATCTACATGTAATTAAAAGTGG + Intronic
1187096475 X:16153983-16154005 AATTTGAATTTATTTGAAAGTGG - Intergenic
1187664315 X:21587566-21587588 AATTTGCATAATCTTAAAACTGG + Intronic
1187837790 X:23453266-23453288 AAATGGCATATATTCAAAAGAGG - Intergenic
1188220704 X:27538160-27538182 AATTTGCATACAAATAATATTGG - Intergenic
1188284357 X:28310216-28310238 AATTAGCATATAATGAGCAGTGG - Intergenic
1188672634 X:32898562-32898584 AATTTACATGTAATTGAAAGTGG - Intronic
1188839853 X:35002812-35002834 AATTTACAGATATTCAAAAGTGG + Intergenic
1188928161 X:36070943-36070965 AATCTGCATGCAATTAAAAATGG + Intronic
1189175034 X:38947925-38947947 AATTTACATATCAGTAAATGAGG + Intergenic
1189190877 X:39103660-39103682 AATTTACTTATAATTTATAGAGG - Intergenic
1189475344 X:41349037-41349059 AATTAGCACAGAATTCAAAGTGG - Exonic
1189743209 X:44142835-44142857 AATTGGCATATAATGAGCAGTGG + Intergenic
1190364632 X:49680082-49680104 AATTTGCATGTGATTGAAAGTGG - Intergenic
1190433061 X:50396216-50396238 AATGTGCATAGTATTAAAAGGGG + Intronic
1190554761 X:51623055-51623077 AATTTGCAGGTAATTGAAAGAGG - Intergenic
1190953323 X:55167480-55167502 AATGTACATATAATTGAAAGTGG + Intronic
1191663040 X:63670121-63670143 AATTGGCCTATAATTAGAATGGG - Intronic
1191907688 X:66111353-66111375 AAGTTGCATATTCTTAGAAGAGG - Intergenic
1192416815 X:70988492-70988514 AATTTGCATGTAACTGAAAGTGG - Intergenic
1192587289 X:72329114-72329136 AATTGGCACATAATGAAAAGGGG - Intergenic
1193695099 X:84698823-84698845 AATTTCCAAAAATTTAAAAGTGG + Intergenic
1194107618 X:89791729-89791751 AATTTACAAATAATTGAAACAGG + Intergenic
1194152784 X:90345671-90345693 AATTTGCATGTAATCGTAAGTGG - Intergenic
1194245726 X:91509613-91509635 AATATGCAGAAAATTAAAACTGG + Intergenic
1194456858 X:94115447-94115469 AATTTTCATATAACTAACAGTGG - Intergenic
1194473775 X:94333818-94333840 AATTTTCTTTTAATTAAAAAAGG - Intergenic
1194479944 X:94409164-94409186 AATTTGTATATCATTGAAAGCGG - Intergenic
1194514737 X:94838361-94838383 AATATGCAAATAAATAGAAGAGG - Intergenic
1194570892 X:95553448-95553470 AATTTGCATATAATTAAATGTGG - Intergenic
1194571824 X:95561880-95561902 AATTTGCATATAATTAAATATGG - Intergenic
1194869000 X:99104011-99104033 ATTTTTCACATAAATAAAAGTGG - Intergenic
1195092038 X:101469929-101469951 AATTTGCGTATAATTAAAAGTGG + Intronic
1195095987 X:101501638-101501660 CATTAGCATATAATTATGAGTGG - Intronic
1195267893 X:103201215-103201237 AATTTGCATGTAACTAAAGGTGG + Intergenic
1195268840 X:103211367-103211389 AATTTGTGTGTAATTGAAAGTGG + Intergenic
1195277627 X:103297821-103297843 AATTTGTACATATTTAAAAGTGG - Intergenic
1195277907 X:103300139-103300161 AATTTGTATATATGTAAAAGTGG - Intergenic
1195373925 X:104207039-104207061 AATTTGCATGTAATTGAAAGTGG - Intergenic
1195389216 X:104343663-104343685 AATTTGCATGTAATTGAAAGTGG - Intergenic
1195446127 X:104955002-104955024 AATTTGCATATAATTAAAACTGG - Intronic
1195447415 X:104970502-104970524 AATTTGCACATAATTAAAAGTGG - Intronic
1195448254 X:104977834-104977856 AATTTGCATATAATAAAACGTGG - Intronic
1195539976 X:106052595-106052617 AATTTGCATATAATTAAATGTGG - Intergenic
1195922882 X:110001073-110001095 AATTTGCATATAATGAGCAGTGG + Intergenic
1196575682 X:117315817-117315839 AATATGCAGATCATTAAAACTGG - Intergenic
1196855764 X:119982031-119982053 GATTAGCACATAATTAAAAGTGG + Intergenic
1196967216 X:121069601-121069623 AATTTGCCTATTTTTAAAATGGG + Intergenic
1197131527 X:123010788-123010810 CATTTGCAGAAAATTGAAAGTGG + Intergenic
1197461516 X:126748377-126748399 ATATTGCATATTATTAACAGTGG - Intergenic
1197469304 X:126848335-126848357 AATCTTCATATGATTGAAAGGGG + Intergenic
1197895598 X:131310516-131310538 AATTTGCATTTTATTAAAATCGG + Intronic
1198175285 X:134148636-134148658 AATCTGCATGCAATTAAAAGTGG + Intergenic
1198271344 X:135059048-135059070 AATTTGCATGTAATTAAAAGTGG + Intergenic
1198272696 X:135069209-135069231 AATTTGCATGCAATTAAAAGTGG + Intergenic
1198735590 X:139781543-139781565 AATTTGCATATTTTTAGTAGAGG - Intronic
1198759780 X:140019188-140019210 AATTTGAATATAATTAAAAGTGG - Intergenic
1198779005 X:140214862-140214884 AATTTGAATATAATTAAAAGTGG + Intergenic
1198846592 X:140918770-140918792 AATTTGCATATAATTAAAAGTGG + Intergenic
1198928523 X:141826037-141826059 AGTTAGCATATAATTAAAATGGG - Intergenic
1199453655 X:148002312-148002334 AATTGGCAAATAATAAAAAATGG + Intronic
1199498196 X:148477809-148477831 AAATTATACATAATTAAAAGGGG + Intergenic
1200319714 X:155174634-155174656 AAATTGCATATAATGTATAGGGG - Intergenic
1200399820 X:156012860-156012882 AATTTGTATATAGTTACAAGTGG + Intergenic
1200459574 Y:3439514-3439536 AATTTACAAATAATTGAAACAGG + Intergenic
1200499128 Y:3922416-3922438 AATTTGCATGTAATCGTAAGTGG - Intergenic
1200564696 Y:4750863-4750885 AATATGCAGAAAATTAAAACTGG + Intergenic
1200576957 Y:4900240-4900262 AGTATGCATATAATGAAAGGTGG - Intergenic
1201269682 Y:12242731-12242753 AATCTGCATGCAATTAAAAATGG - Intergenic
1201535282 Y:15041069-15041091 AATTGAGATATAATTAATAGAGG + Intergenic
1201542443 Y:15120978-15121000 TATTTTCATAAAATTAAATGTGG + Intergenic
1201690471 Y:16759106-16759128 TTTTTACAAATAATTAAAAGAGG - Intergenic
1201920423 Y:19228007-19228029 AATTAGCATATAATGAGCAGTGG + Intergenic
1202040893 Y:20682370-20682392 AATTGGCTTATAAATTAAAGAGG + Intergenic
1202276900 Y:23131881-23131903 CATTTTCATATAAATAAAAGTGG + Intronic
1202289128 Y:23288808-23288830 CATTTTCATATAAATAAAAGTGG - Intronic
1202429892 Y:24765595-24765617 CATTTTCATATAAATAAAAGTGG + Intronic
1202440900 Y:24904492-24904514 CATTTTCATATAAATAAAAGTGG - Intronic