ID: 1123870931

View in Genome Browser
Species Human (GRCh38)
Location 15:24571872-24571894
Sequence GGGCAGATCAATGCAAATTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123870927_1123870931 3 Left 1123870927 15:24571846-24571868 CCACTTTTAATTATATGCAAATT 0: 59
1: 175
2: 188
3: 281
4: 719
Right 1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG No data
1123870926_1123870931 4 Left 1123870926 15:24571845-24571867 CCCACTTTTAATTATATGCAAAT 0: 55
1: 173
2: 196
3: 314
4: 680
Right 1123870931 15:24571872-24571894 GGGCAGATCAATGCAAATTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123870931 Original CRISPR GGGCAGATCAATGCAAATTG AGG Intergenic
No off target data available for this crispr