ID: 1123871462

View in Genome Browser
Species Human (GRCh38)
Location 15:24578921-24578943
Sequence TTCTGCCCAGAAAACTGAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123871462_1123871465 3 Left 1123871462 15:24578921-24578943 CCACTTCAGTTTTCTGGGCAGAA No data
Right 1123871465 15:24578947-24578969 AGGATTGTAAGGAGAAATTTTGG No data
1123871462_1123871466 11 Left 1123871462 15:24578921-24578943 CCACTTCAGTTTTCTGGGCAGAA No data
Right 1123871466 15:24578955-24578977 AAGGAGAAATTTTGGTATACAGG No data
1123871462_1123871467 12 Left 1123871462 15:24578921-24578943 CCACTTCAGTTTTCTGGGCAGAA No data
Right 1123871467 15:24578956-24578978 AGGAGAAATTTTGGTATACAGGG No data
1123871462_1123871468 23 Left 1123871462 15:24578921-24578943 CCACTTCAGTTTTCTGGGCAGAA No data
Right 1123871468 15:24578967-24578989 TGGTATACAGGGCATGCAGAAGG No data
1123871462_1123871464 -8 Left 1123871462 15:24578921-24578943 CCACTTCAGTTTTCTGGGCAGAA No data
Right 1123871464 15:24578936-24578958 GGGCAGAAAGCAGGATTGTAAGG No data
1123871462_1123871469 24 Left 1123871462 15:24578921-24578943 CCACTTCAGTTTTCTGGGCAGAA No data
Right 1123871469 15:24578968-24578990 GGTATACAGGGCATGCAGAAGGG No data
1123871462_1123871470 25 Left 1123871462 15:24578921-24578943 CCACTTCAGTTTTCTGGGCAGAA No data
Right 1123871470 15:24578969-24578991 GTATACAGGGCATGCAGAAGGGG No data
1123871462_1123871471 30 Left 1123871462 15:24578921-24578943 CCACTTCAGTTTTCTGGGCAGAA No data
Right 1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123871462 Original CRISPR TTCTGCCCAGAAAACTGAAG TGG (reversed) Intergenic
No off target data available for this crispr