ID: 1123871471

View in Genome Browser
Species Human (GRCh38)
Location 15:24578974-24578996
Sequence CAGGGCATGCAGAAGGGGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123871462_1123871471 30 Left 1123871462 15:24578921-24578943 CCACTTCAGTTTTCTGGGCAGAA No data
Right 1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123871471 Original CRISPR CAGGGCATGCAGAAGGGGCA TGG Intergenic
No off target data available for this crispr