ID: 1123875421

View in Genome Browser
Species Human (GRCh38)
Location 15:24618984-24619006
Sequence AACTGAAGGAAGTTGGGATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123875421_1123875427 20 Left 1123875421 15:24618984-24619006 CCACATCCCAACTTCCTTCAGTT No data
Right 1123875427 15:24619027-24619049 TTTTGTCTTGTCCTAGCTGTGGG No data
1123875421_1123875428 21 Left 1123875421 15:24618984-24619006 CCACATCCCAACTTCCTTCAGTT No data
Right 1123875428 15:24619028-24619050 TTTGTCTTGTCCTAGCTGTGGGG No data
1123875421_1123875426 19 Left 1123875421 15:24618984-24619006 CCACATCCCAACTTCCTTCAGTT No data
Right 1123875426 15:24619026-24619048 TTTTTGTCTTGTCCTAGCTGTGG No data
1123875421_1123875425 -8 Left 1123875421 15:24618984-24619006 CCACATCCCAACTTCCTTCAGTT No data
Right 1123875425 15:24618999-24619021 CTTCAGTTCAGCTGTGATTTTGG 0: 4
1: 260
2: 539
3: 669
4: 749
1123875421_1123875429 25 Left 1123875421 15:24618984-24619006 CCACATCCCAACTTCCTTCAGTT No data
Right 1123875429 15:24619032-24619054 TCTTGTCCTAGCTGTGGGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123875421 Original CRISPR AACTGAAGGAAGTTGGGATG TGG (reversed) Intergenic
No off target data available for this crispr