ID: 1123880916

View in Genome Browser
Species Human (GRCh38)
Location 15:24676819-24676841
Sequence GGCCTGTTGCGGGCAGCTCT GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 193
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123880916 Original CRISPR GGCCTGTTGCGGGCAGCTCT GGG (reversed) Exonic