ID: 1123881530

View in Genome Browser
Species Human (GRCh38)
Location 15:24680680-24680702
Sequence GTGGTCTTCTGCACTGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123881525_1123881530 2 Left 1123881525 15:24680655-24680677 CCAGTCAGAACCGCACTGTATTT 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1123881530 15:24680680-24680702 GTGGTCTTCTGCACTGTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 181
1123881524_1123881530 3 Left 1123881524 15:24680654-24680676 CCCAGTCAGAACCGCACTGTATT 0: 1
1: 0
2: 2
3: 6
4: 58
Right 1123881530 15:24680680-24680702 GTGGTCTTCTGCACTGTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 181
1123881527_1123881530 -8 Left 1123881527 15:24680665-24680687 CCGCACTGTATTTTAGTGGTCTT 0: 1
1: 0
2: 0
3: 21
4: 193
Right 1123881530 15:24680680-24680702 GTGGTCTTCTGCACTGTGGAGGG 0: 1
1: 0
2: 2
3: 23
4: 181

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123881530 Original CRISPR GTGGTCTTCTGCACTGTGGA GGG Exonic
900102367 1:967343-967365 GTGGTCTTCTGCTCCTTTGACGG - Intronic
900520403 1:3102588-3102610 GGGGTTTTCTGCACTGTGCATGG + Intronic
901429056 1:9201399-9201421 ATGGTCTTGTTCACTGGGGATGG - Intergenic
902227600 1:15006507-15006529 GTGGGCCTCAGCCCTGTGGATGG - Intronic
902616035 1:17624089-17624111 TTGGGCTGCTGCACTGGGGATGG + Intronic
902812197 1:18894637-18894659 CTGGGCCTCTGCCCTGTGGAAGG - Intronic
903726480 1:25450281-25450303 GTGGTTCTCTACACTGTGGCAGG + Intronic
905029386 1:34871400-34871422 GTGGTCTTGTGGGCAGTGGAGGG - Intronic
905650952 1:39656692-39656714 GTGGACCTGTGCACTGGGGACGG - Intergenic
907348568 1:53805460-53805482 GTGGTCTTCAGCACTTTGGGAGG - Intronic
909174516 1:72339160-72339182 GGGGTCTACTTCACTGGGGAGGG + Intergenic
911037667 1:93567634-93567656 GTTATCTGCAGCACTGTGGATGG - Intronic
911046903 1:93636210-93636232 GGGGTCATCTGCACTGTGAAGGG + Intronic
919196514 1:194294123-194294145 GTGGTCTTCTTGGCTGTGGGAGG + Intergenic
920854034 1:209649141-209649163 CTTGTCTTCTGGGCTGTGGAAGG - Intronic
923265924 1:232314226-232314248 GTCGACTTCTGTGCTGTGGAAGG - Intergenic
1063646463 10:7888518-7888540 GTGGAGGTCTGCAGTGTGGAGGG + Intronic
1063731544 10:8703020-8703042 GTGGTTTTCTGAACTCTGCAAGG + Intergenic
1064005949 10:11699220-11699242 GTGGCCTGCTCCACTGTGAAAGG - Intergenic
1064495081 10:15901091-15901113 GGGGCCTGCTGCAGTGTGGAGGG + Intergenic
1067347848 10:45450433-45450455 GTGGTCTTTTGCAGAGCGGAAGG - Intergenic
1067562789 10:47315453-47315475 GTGGTCTTCTATACATTGGAGGG - Intergenic
1069903572 10:71719664-71719686 GAGGTCTTCTCAGCTGTGGAAGG + Exonic
1070144125 10:73761330-73761352 GTAGGCTTCTGCTGTGTGGATGG + Intronic
1070796765 10:79221461-79221483 GTGACCTTCTGTACTGAGGAGGG - Intronic
1071347296 10:84704905-84704927 CTGCTCTTCTGCTCTGTGAAGGG + Intergenic
1071515792 10:86295882-86295904 CTGCTCACCTGCACTGTGGAGGG + Intronic
1071633926 10:87235008-87235030 GTGCTGTGCTGCTCTGTGGAGGG + Intronic
1074712957 10:116192745-116192767 GGGGTTTCCAGCACTGTGGAGGG - Intronic
1074999383 10:118783826-118783848 GTCCCCTTGTGCACTGTGGAAGG + Intergenic
1075574277 10:123567288-123567310 GAGGTCATCTGCGGTGTGGAAGG + Intergenic
1077158189 11:1100804-1100826 GTGGTCGTCTGCACAGTGCTGGG - Intergenic
1077198836 11:1295398-1295420 GTGGGCGTCTGCTCTGTGTAGGG - Intronic
1078426095 11:11252633-11252655 GTGGTCTTCTGCTCTGGGGATGG + Intergenic
1078739644 11:14054652-14054674 ATTTTCTTCTGCACTTTGGAAGG - Intronic
1078891479 11:15561833-15561855 GTCAGCTTCTGCATTGTGGAAGG + Intergenic
1079032686 11:16997370-16997392 GGGCTCTTCTTCACAGTGGAAGG - Intronic
1079052265 11:17172431-17172453 GTGGTCATCTGGAGTGTGGATGG - Intronic
1079116911 11:17645897-17645919 GTGGGCTCCTGCACTGTATAGGG - Exonic
1081568444 11:44275119-44275141 TTGGGCTTCTGCACTGTGGTGGG - Intronic
1082026143 11:47573698-47573720 GTCATCTTCTGCACAGTGCAAGG + Exonic
1084087637 11:66861886-66861908 GTGGGCTTCTGCACCCTGGAGGG - Intronic
1088222797 11:107587705-107587727 CTGGTCTTAAGCACTGTGGGAGG - Intergenic
1091286937 11:134412792-134412814 GGGGTCTGCTGCCCCGTGGAAGG + Intergenic
1093738465 12:22652468-22652490 GTGCCCTTGTGCACTGTTGATGG - Intronic
1097617903 12:61906134-61906156 GTGATATTCTGCAGTGTGGTGGG - Intronic
1098190971 12:67947900-67947922 GTGGTCAACTCCACTGTGCAAGG + Intergenic
1099878026 12:88433362-88433384 GTGGACTTCTGCAATTTGCAAGG + Intergenic
1100934434 12:99647587-99647609 GTGGTCTGCTGAGCTGTGGAGGG + Intronic
1104576411 12:129970638-129970660 GAACTCTTCTGCACTGTTGATGG + Intergenic
1104684657 12:130776866-130776888 CTGTTCTGCTGCACTGTGGCTGG + Intergenic
1104971029 12:132530759-132530781 CTGGCCTGCTGCACTGGGGATGG + Intronic
1108517581 13:51217607-51217629 TTGGGCTTGTGCACTGTGGCTGG + Intergenic
1109764441 13:66875390-66875412 GTCTTCTTATGCACTGTGGTAGG + Intronic
1110762146 13:79242506-79242528 GTGATCTTTTGCTCTGGGGATGG - Intergenic
1111043957 13:82790217-82790239 GTGGTCTTCTGAAAGGTTGATGG - Intergenic
1112323436 13:98427666-98427688 GTGGTCTTCTGCGCTGGGTTAGG - Intronic
1116689019 14:48081076-48081098 GTGCAGTTCTCCACTGTGGATGG - Intergenic
1118276967 14:64394036-64394058 GGGGCCTTCTGCACTGTGGATGG - Intronic
1118605485 14:67499937-67499959 GTGGTCTCCTGGCCAGTGGAAGG + Intronic
1119630662 14:76229068-76229090 GTGGGCTGCAGCCCTGTGGATGG - Intronic
1119906788 14:78312076-78312098 CTGGTCATCTTCACTGTTGATGG + Intronic
1121480580 14:94267985-94268007 GTGGTTTTCTGCAAGGTAGATGG + Intronic
1122210582 14:100171410-100171432 GGAGACTCCTGCACTGTGGATGG + Intergenic
1123823016 15:24050426-24050448 GTGCTCTTCTCCACTGTGCCAGG - Intergenic
1123881530 15:24680680-24680702 GTGGTCTTCTGCACTGTGGAGGG + Exonic
1125691691 15:41601076-41601098 GTGTTCTTCTGCACTCTTCAGGG + Intergenic
1125953545 15:43774320-43774342 TTGCTGTTCTGCACTGTGGATGG + Exonic
1126842904 15:52734460-52734482 ATGGGTTTCTGCACTGTGGAAGG + Intergenic
1126951112 15:53882807-53882829 GTGTTCTTCTCCACTGAGGATGG + Intergenic
1127155754 15:56123041-56123063 GTGGTCTTCCCCACTGTGGCTGG + Intronic
1128313722 15:66647253-66647275 GGTGTCTTCGGCACTGTGCAGGG - Intronic
1128332844 15:66767236-66767258 ATGTTCTTTTGAACTGTGGAAGG - Intronic
1130081185 15:80735089-80735111 GTCTTCCTCTGCACTGTGGCAGG + Intronic
1132065949 15:98731553-98731575 GTGCTCTTCAGCTCTGTGGCTGG + Intronic
1133139950 16:3736330-3736352 GGGGTCTGCTGCACTGTGGTGGG - Intronic
1133339848 16:5029073-5029095 GTGATGCTCTGCACTGTGGAAGG - Intronic
1134425779 16:14142744-14142766 ATGGTCTTCTGTAATGGGGAGGG + Intronic
1134450964 16:14363204-14363226 GTGGTGTTCCGCGGTGTGGAGGG - Intergenic
1135740162 16:24968289-24968311 GTGGTCTTCTCCCCCGTGGTGGG + Intronic
1135789426 16:25379851-25379873 GTGGTTTTCTGCCCTGGGGTGGG - Intergenic
1136271839 16:29153293-29153315 GGGGTCGTGTGCACTGTGCAAGG - Intergenic
1136859595 16:33690216-33690238 GTGCTCTGCTTCAGTGTGGAGGG - Intergenic
1137629756 16:49934668-49934690 CTGGTCATCTGGACTGTGGCAGG - Intergenic
1138351312 16:56347653-56347675 GTGGTCTTGTGCACTGGGCCTGG - Exonic
1138389362 16:56658868-56658890 CTAGTCTTCTGCCCTGTGCAGGG + Intronic
1139162039 16:64521742-64521764 GGGGCCTTCTGGACGGTGGAGGG - Intergenic
1203121101 16_KI270728v1_random:1538395-1538417 GTGCTCTGCTTCAGTGTGGAGGG - Intergenic
1142478815 17:205505-205527 ATGCTCTTCTGCACAGGGGAGGG - Intergenic
1144201071 17:12943267-12943289 GTTGCCTTTTGCACTGAGGATGG + Intronic
1144843394 17:18202730-18202752 GTGTTCTCTTGCACTGAGGAGGG + Intronic
1146194302 17:30798438-30798460 GTGTTCTTCAGGGCTGTGGAAGG - Intronic
1146968261 17:37051303-37051325 GTGGTTTTCTGTAGAGTGGATGG + Intronic
1148856683 17:50582794-50582816 GTGGTCTCCTGGGCTGTAGACGG + Intronic
1153413099 18:4815992-4816014 GTCCTCTTCCACACTGTGGAGGG + Intergenic
1154193250 18:12247579-12247601 GTGGGATTCTGCACTGTGGGTGG - Intergenic
1155317107 18:24582943-24582965 TTTGTCTTCTCTACTGTGGATGG - Intergenic
1156563990 18:38163162-38163184 TTGGTTTCCTGAACTGTGGAGGG - Intergenic
1157513485 18:48295107-48295129 CTGGGCTTCTCCCCTGTGGAGGG - Intronic
1158481281 18:57823906-57823928 GTGCTCTTCTCCACTGTGGCAGG + Intergenic
1160376283 18:78415042-78415064 GGGGTCTGCAGGACTGTGGAGGG - Intergenic
1160996784 19:1885609-1885631 GTGGCCTGCTGCTCTGTGGGCGG + Intergenic
1161738667 19:6007154-6007176 GGGGTCTTCGTCACTGTGGAGGG + Exonic
1162497148 19:11029615-11029637 GTGGGCTTCTGCACCGTGCCTGG + Intronic
1163618944 19:18346390-18346412 GTTTTGTTCTGCACTGTGGGTGG + Intronic
1166622167 19:44311104-44311126 GTAATCCTCTGCACTTTGGAAGG - Intergenic
1166683014 19:44779425-44779447 CTGCTGTTCTGCACTGAGGAAGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
1168353262 19:55688153-55688175 CCTGTCCTCTGCACTGTGGAGGG + Intronic
925114746 2:1369245-1369267 GTGTTCTTCTGCACCAAGGAGGG + Intergenic
925931508 2:8711919-8711941 GAGGGCTGCTGCAGTGTGGAAGG + Intergenic
926228463 2:10984980-10985002 GAGGTCTGCTACACTCTGGAAGG - Intergenic
927198501 2:20564270-20564292 GTGGTCTACTGCAGGGTGGACGG + Intronic
928333477 2:30375569-30375591 CTGCTATTCTGCTCTGTGGAGGG - Intergenic
929129938 2:38557309-38557331 GAGGTCTTGTGCACAGTGAACGG - Intergenic
932934658 2:76088574-76088596 TTGCTCTTCTCCACTGTGGCTGG + Intergenic
933814160 2:86052425-86052447 GTGCCATTCTGCACTGTGAACGG + Intronic
938388142 2:130882405-130882427 GTGGCCTTCTGCAACCTGGAAGG - Intronic
939999803 2:148955792-148955814 GTGTGATTCTGCACTGTGAATGG - Intronic
942329919 2:174812197-174812219 GTTGTCTTCTGTAATTTGGAGGG - Intronic
945339383 2:208633417-208633439 GTTGTCTGCAGCAATGTGGATGG - Intronic
945604414 2:211910563-211910585 GGGGTCTTTTGCAGGGTGGAGGG + Intronic
945885621 2:215372288-215372310 GGGGTCTTTTGAACTGTGGAAGG + Exonic
946054122 2:216886053-216886075 GTTCTCTTCCACACTGTGGAGGG + Intergenic
948493261 2:238327473-238327495 GAGGTGTCCTGCACTCTGGATGG + Intronic
948880478 2:240854768-240854790 CTGGAATTCTGCCCTGTGGAGGG - Intergenic
949050152 2:241893459-241893481 GTGGTCTCCTGGACAGAGGAGGG - Intergenic
1168850904 20:976344-976366 ATGGTCTTTTGCCCTCTGGATGG + Intronic
1170057737 20:12225422-12225444 GTGGTCTTTTGCAGTATGGAGGG - Intergenic
1171798513 20:29584894-29584916 ATGTTCTTTTTCACTGTGGAGGG - Intergenic
1171845580 20:30272279-30272301 ATGTTCTTTTTCACTGTGGAGGG + Intergenic
1173195824 20:40911988-40912010 GTCTTCTTCCACACTGTGGAAGG + Intergenic
1175968655 20:62672914-62672936 GTGGTCCCCAGCACTGAGGATGG + Intronic
1179233436 21:39525581-39525603 GAGGTCTTCGGCACTGTACATGG - Intergenic
1181349856 22:22247068-22247090 GTGGTCTCCAGCACTTTGGGAGG + Intergenic
1181872580 22:25911680-25911702 GTGGGCTACTGCAATGTGGTGGG - Intronic
1182447653 22:30398757-30398779 ATGGTCTTCTGCCCCATGGAAGG - Intronic
1183649340 22:39145294-39145316 CTGGGCTCCTGCACTGCGGAGGG - Intronic
949313450 3:2725765-2725787 CTGGTCTTCAGCAATGTGGCAGG - Intronic
949358262 3:3204360-3204382 CTGTTCTTCTGCACTCTGGAGGG + Intergenic
949400869 3:3664236-3664258 GTGGTCTTCCTCAATGTGGGTGG - Intergenic
950198963 3:11029215-11029237 CTGAAGTTCTGCACTGTGGAGGG + Exonic
951892488 3:27580188-27580210 GCGGTTTTCTGCACCCTGGAGGG - Intergenic
952214543 3:31264382-31264404 ATGGTCTCTTCCACTGTGGATGG - Intergenic
952275404 3:31871122-31871144 GTCCCCTTCTGCACTGTAGAAGG + Intronic
952495895 3:33915454-33915476 GTTGTCCTGTGCACTGTGTAGGG + Intergenic
952839203 3:37630116-37630138 GTGGTCTGAAGCACTGTGAAAGG - Intronic
952963990 3:38609952-38609974 ATGGTCTTCAGCCCTGGGGAAGG + Exonic
953207776 3:40847161-40847183 GAGGGTTTCTGCTCTGTGGAAGG + Intergenic
953237582 3:41119882-41119904 GTCCTCTTCTGCTCTCTGGAAGG - Intergenic
954371970 3:50173783-50173805 GTGGCCTTCAGCTCTGTGGGTGG - Exonic
954803778 3:53203108-53203130 GTGGTTTTCTGCATTGGCGATGG + Intergenic
956543391 3:70370419-70370441 GTAGTCTTATACACTGTTGATGG - Intergenic
958049869 3:88332114-88332136 GAGCTCCTCTGAACTGTGGAGGG + Intergenic
959297808 3:104559276-104559298 ATGCTCTTTTGCACTGTTGATGG + Intergenic
961806192 3:129491049-129491071 GTGGACCTCTGAATTGTGGAGGG + Intronic
962468146 3:135679642-135679664 GGGGTTCTCTGCACTGTGCAAGG - Intergenic
963554797 3:146773229-146773251 GTCGTCTTCTGCAGCGTGGGAGG + Intergenic
963979780 3:151524616-151524638 GTGGTCTACTTGAGTGTGGAGGG + Intergenic
970235357 4:13953082-13953104 GTTGTCCTGTGCACTGTGAAGGG - Intergenic
970625306 4:17870741-17870763 ATGCTCTTAAGCACTGTGGAAGG - Intronic
970755519 4:19421367-19421389 GATGTCTGCTGCAATGTGGAGGG - Intergenic
971757738 4:30722791-30722813 GTGGTCACCTGCACCGTGGTGGG + Exonic
972394339 4:38645893-38645915 GTGGTCGTTTGCAATGTGGCAGG - Intergenic
974186952 4:58458158-58458180 GTCCCCTTCTACACTGTGGAAGG + Intergenic
981194892 4:141907403-141907425 GTGAGTTTCTGCAATGTGGAAGG - Intergenic
982247115 4:153364133-153364155 GAGCTCTTGTGCACTGTTGATGG + Intronic
983752983 4:171299124-171299146 GTGCCCTTCCACACTGTGGAAGG + Intergenic
983969866 4:173858296-173858318 GTTGACTTCTGCACTGGAGAGGG + Intergenic
984556285 4:181217985-181218007 CTGTTCATCTGCATTGTGGAGGG + Intergenic
985520345 5:371200-371222 GTGGTCTTCCCCAGTGTGGCTGG - Intronic
986010556 5:3710965-3710987 GTGGTCCTCTCCACTGGGCATGG - Intergenic
987494221 5:18622343-18622365 GAGGAGTTCTGCACTGTGGATGG - Intergenic
988898671 5:35707596-35707618 GTGGGCCTCTGCAGTGTGAAGGG + Intronic
990907662 5:60821117-60821139 GTGGCCTTGTGTACAGTGGATGG - Intronic
997862728 5:137433023-137433045 ATGGTTTCCTGCCCTGTGGAAGG + Intronic
1006352791 6:33533314-33533336 GTTTTCTTCAACACTGTGGAAGG + Intergenic
1007111743 6:39316856-39316878 ATGGTCTTCAGCCATGTGGAGGG - Exonic
1008644652 6:53501346-53501368 GTGATCTTCTGCCCTTGGGAGGG - Intronic
1008929613 6:56924823-56924845 GATCTCTCCTGCACTGTGGATGG - Intronic
1016364322 6:143299157-143299179 GTGGTCTTCTCCAGGGTAGATGG + Intronic
1016721074 6:147298529-147298551 ATATTCTTCTGCACTGTGCATGG + Intronic
1017959847 6:159212069-159212091 GAGGTCTACTGCAATCTGGATGG + Intronic
1025800207 7:64779930-64779952 GTGGTCTGTTGTACTGTGGTAGG + Intergenic
1027819306 7:83023775-83023797 CTCCTCTTCTGCACTGTGGTGGG - Intronic
1029776349 7:102686807-102686829 GTGGCTGTCTGCGCTGTGGAAGG - Intergenic
1032335429 7:131020510-131020532 ATTCTCTTCTTCACTGTGGAAGG - Intergenic
1032679761 7:134169362-134169384 CTGGTCTCCAGAACTGTGGAAGG + Intronic
1033639666 7:143249352-143249374 CTGGTGTTCTGCACTGGGGATGG - Intronic
1034465131 7:151223542-151223564 ATGGACATCTGCAGTGTGGAGGG - Intronic
1034917694 7:155054465-155054487 GCTGTCTTCTGGGCTGTGGAAGG + Intergenic
1042680805 8:71381036-71381058 GGGGTCTTGTGAACTGTTGAAGG - Intergenic
1048332933 8:133483423-133483445 GTGGTCATCTACTCTGTGGCGGG - Intronic
1049536359 8:143184221-143184243 GTGGTCTGTTGCACTGCAGAGGG + Intergenic
1049812802 8:144583044-144583066 GTGGTTTGCTGGACGGTGGACGG - Intronic
1054749944 9:68895455-68895477 GTGGTTTTCTGCACTTTCCATGG + Intronic
1055339421 9:75265076-75265098 ATAGTCTTCTGCAGTGTGAAAGG + Intergenic
1057172234 9:92969774-92969796 GGGGACCGCTGCACTGTGGAGGG + Intronic
1057858855 9:98624147-98624169 GTGGTCCTGGGCACTGTGGAGGG + Intronic
1058655332 9:107215586-107215608 GTGCTCCTCTGCTCAGTGGAAGG - Intergenic
1061504945 9:131026524-131026546 GTGGCCTTCTCCACCCTGGAGGG + Exonic
1187364221 X:18653331-18653353 GTGGCCTTCTGCTCCGTGGGGGG + Intronic
1192696912 X:73426439-73426461 AGTTTCTTCTGCACTGTGGAGGG - Intergenic
1196800661 X:119540593-119540615 GTGGTTTTCTGCACTATTCATGG - Intronic
1198524161 X:137483373-137483395 TTCGTTTTCTGCATTGTGGATGG + Intergenic
1200953296 Y:8921367-8921389 GTGGTCTTCCACACTGTAAATGG + Intergenic
1201496780 Y:14597318-14597340 GTCCTCTTCCACACTGTGGAAGG - Intronic