ID: 1123887027

View in Genome Browser
Species Human (GRCh38)
Location 15:24736215-24736237
Sequence TCCCTTTGGGTCCCCTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123887027_1123887031 1 Left 1123887027 15:24736215-24736237 CCAAGACAGGGGACCCAAAGGGA No data
Right 1123887031 15:24736239-24736261 AGAGCAGTGTGGCAAGCAAAAGG No data
1123887027_1123887033 27 Left 1123887027 15:24736215-24736237 CCAAGACAGGGGACCCAAAGGGA No data
Right 1123887033 15:24736265-24736287 GCTGAAGAGGCAGTGAGCCAAGG No data
1123887027_1123887029 -10 Left 1123887027 15:24736215-24736237 CCAAGACAGGGGACCCAAAGGGA No data
Right 1123887029 15:24736228-24736250 CCCAAAGGGAGAGAGCAGTGTGG No data
1123887027_1123887032 14 Left 1123887027 15:24736215-24736237 CCAAGACAGGGGACCCAAAGGGA No data
Right 1123887032 15:24736252-24736274 AAGCAAAAGGCATGCTGAAGAGG No data
1123887027_1123887034 30 Left 1123887027 15:24736215-24736237 CCAAGACAGGGGACCCAAAGGGA No data
Right 1123887034 15:24736268-24736290 GAAGAGGCAGTGAGCCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123887027 Original CRISPR TCCCTTTGGGTCCCCTGTCT TGG (reversed) Intergenic
No off target data available for this crispr