ID: 1123893864

View in Genome Browser
Species Human (GRCh38)
Location 15:24809143-24809165
Sequence AGCGTCTTAGAGAGGTCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123893853_1123893864 14 Left 1123893853 15:24809106-24809128 CCCCACGACCCCCTTGGACACTG No data
Right 1123893864 15:24809143-24809165 AGCGTCTTAGAGAGGTCGGAGGG No data
1123893858_1123893864 5 Left 1123893858 15:24809115-24809137 CCCCTTGGACACTGGAGCTAGCA No data
Right 1123893864 15:24809143-24809165 AGCGTCTTAGAGAGGTCGGAGGG No data
1123893860_1123893864 3 Left 1123893860 15:24809117-24809139 CCTTGGACACTGGAGCTAGCAGA No data
Right 1123893864 15:24809143-24809165 AGCGTCTTAGAGAGGTCGGAGGG No data
1123893856_1123893864 12 Left 1123893856 15:24809108-24809130 CCACGACCCCCTTGGACACTGGA No data
Right 1123893864 15:24809143-24809165 AGCGTCTTAGAGAGGTCGGAGGG No data
1123893859_1123893864 4 Left 1123893859 15:24809116-24809138 CCCTTGGACACTGGAGCTAGCAG No data
Right 1123893864 15:24809143-24809165 AGCGTCTTAGAGAGGTCGGAGGG No data
1123893851_1123893864 29 Left 1123893851 15:24809091-24809113 CCTGGCAGCTGGAGACCCCACGA No data
Right 1123893864 15:24809143-24809165 AGCGTCTTAGAGAGGTCGGAGGG No data
1123893854_1123893864 13 Left 1123893854 15:24809107-24809129 CCCACGACCCCCTTGGACACTGG No data
Right 1123893864 15:24809143-24809165 AGCGTCTTAGAGAGGTCGGAGGG No data
1123893857_1123893864 6 Left 1123893857 15:24809114-24809136 CCCCCTTGGACACTGGAGCTAGC No data
Right 1123893864 15:24809143-24809165 AGCGTCTTAGAGAGGTCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123893864 Original CRISPR AGCGTCTTAGAGAGGTCGGA GGG Intergenic