ID: 1123904138

View in Genome Browser
Species Human (GRCh38)
Location 15:24905334-24905356
Sequence TTGTATATTTAGTAGAGACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 531188
Summary {0: 482, 1: 65216, 2: 161992, 3: 186495, 4: 117003}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123904138_1123904146 28 Left 1123904138 15:24905334-24905356 CCCTGTCTCTACTAAATATACAA 0: 482
1: 65216
2: 161992
3: 186495
4: 117003
Right 1123904146 15:24905385-24905407 TGTAGTCTTAGCAGCTCAGGAGG 0: 2
1: 17
2: 572
3: 8470
4: 70355
1123904138_1123904142 -6 Left 1123904138 15:24905334-24905356 CCCTGTCTCTACTAAATATACAA 0: 482
1: 65216
2: 161992
3: 186495
4: 117003
Right 1123904142 15:24905351-24905373 ATACAAAAATTAACTGGGCATGG 0: 698
1: 24616
2: 55042
3: 97835
4: 114860
1123904138_1123904143 -3 Left 1123904138 15:24905334-24905356 CCCTGTCTCTACTAAATATACAA 0: 482
1: 65216
2: 161992
3: 186495
4: 117003
Right 1123904143 15:24905354-24905376 CAAAAATTAACTGGGCATGGTGG 0: 680
1: 25225
2: 71189
3: 139880
4: 182213
1123904138_1123904144 25 Left 1123904138 15:24905334-24905356 CCCTGTCTCTACTAAATATACAA 0: 482
1: 65216
2: 161992
3: 186495
4: 117003
Right 1123904144 15:24905382-24905404 GCCTGTAGTCTTAGCAGCTCAGG 0: 2
1: 12
2: 561
3: 10391
4: 110969

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123904138 Original CRISPR TTGTATATTTAGTAGAGACA GGG (reversed) Intronic
Too many off-targets to display for this crispr