ID: 1123904139

View in Genome Browser
Species Human (GRCh38)
Location 15:24905335-24905357
Sequence TTTGTATATTTAGTAGAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 575085
Summary {0: 1327, 1: 168386, 2: 211929, 3: 125950, 4: 67493}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123904139_1123904142 -7 Left 1123904139 15:24905335-24905357 CCTGTCTCTACTAAATATACAAA 0: 1327
1: 168386
2: 211929
3: 125950
4: 67493
Right 1123904142 15:24905351-24905373 ATACAAAAATTAACTGGGCATGG 0: 698
1: 24616
2: 55042
3: 97835
4: 114860
1123904139_1123904144 24 Left 1123904139 15:24905335-24905357 CCTGTCTCTACTAAATATACAAA 0: 1327
1: 168386
2: 211929
3: 125950
4: 67493
Right 1123904144 15:24905382-24905404 GCCTGTAGTCTTAGCAGCTCAGG 0: 2
1: 12
2: 561
3: 10391
4: 110969
1123904139_1123904143 -4 Left 1123904139 15:24905335-24905357 CCTGTCTCTACTAAATATACAAA 0: 1327
1: 168386
2: 211929
3: 125950
4: 67493
Right 1123904143 15:24905354-24905376 CAAAAATTAACTGGGCATGGTGG 0: 680
1: 25225
2: 71189
3: 139880
4: 182213
1123904139_1123904146 27 Left 1123904139 15:24905335-24905357 CCTGTCTCTACTAAATATACAAA 0: 1327
1: 168386
2: 211929
3: 125950
4: 67493
Right 1123904146 15:24905385-24905407 TGTAGTCTTAGCAGCTCAGGAGG 0: 2
1: 17
2: 572
3: 8470
4: 70355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123904139 Original CRISPR TTTGTATATTTAGTAGAGAC AGG (reversed) Intronic
Too many off-targets to display for this crispr