ID: 1123904146

View in Genome Browser
Species Human (GRCh38)
Location 15:24905385-24905407
Sequence TGTAGTCTTAGCAGCTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79416
Summary {0: 2, 1: 17, 2: 572, 3: 8470, 4: 70355}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123904138_1123904146 28 Left 1123904138 15:24905334-24905356 CCCTGTCTCTACTAAATATACAA 0: 482
1: 65216
2: 161992
3: 186495
4: 117003
Right 1123904146 15:24905385-24905407 TGTAGTCTTAGCAGCTCAGGAGG 0: 2
1: 17
2: 572
3: 8470
4: 70355
1123904139_1123904146 27 Left 1123904139 15:24905335-24905357 CCTGTCTCTACTAAATATACAAA 0: 1327
1: 168386
2: 211929
3: 125950
4: 67493
Right 1123904146 15:24905385-24905407 TGTAGTCTTAGCAGCTCAGGAGG 0: 2
1: 17
2: 572
3: 8470
4: 70355

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123904146 Original CRISPR TGTAGTCTTAGCAGCTCAGG AGG Intronic
Too many off-targets to display for this crispr