ID: 1123906791

View in Genome Browser
Species Human (GRCh38)
Location 15:24929553-24929575
Sequence TGGGTGTCCCCTCATGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 145
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123906783_1123906791 15 Left 1123906783 15:24929515-24929537 CCTGGGAAGCTCAGGGAAGCTGC 0: 1
1: 0
2: 5
3: 56
4: 395
Right 1123906791 15:24929553-24929575 TGGGTGTCCCCTCATGAGGGTGG 0: 1
1: 0
2: 0
3: 9
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123906791 Original CRISPR TGGGTGTCCCCTCATGAGGG TGG Intronic
900539954 1:3197695-3197717 AGGGCGGCCCCTCCTGAGGGTGG + Intronic
900571798 1:3362317-3362339 TGGGTGTCCCATGCAGAGGGTGG - Intronic
901651164 1:10743953-10743975 TGGGTGTCCCCTGAGGCGGCTGG - Intronic
904490868 1:30858279-30858301 TGGGTGTCTCTTGCTGAGGGAGG - Intergenic
905361927 1:37426789-37426811 AGGGTGCCCCCTTAGGAGGGTGG - Intergenic
907391304 1:54160224-54160246 TGGGGGTCCCTACATGATGGAGG + Intronic
907459603 1:54597476-54597498 GGGGTTTCCCCTCCAGAGGGAGG - Intronic
912867008 1:113266704-113266726 TGGGTGGCCCCTAATGAAGGCGG - Intergenic
917400040 1:174637669-174637691 TTCGTGCCTCCTCATGAGGGAGG + Intronic
918086295 1:181247966-181247988 GGGGTGTCCCTGCATGAGGAAGG - Intergenic
918257408 1:182761748-182761770 AGGGTCTCCACTCCTGAGGGGGG - Intergenic
920418552 1:205814114-205814136 TGGGGGTTCCTTTATGAGGGAGG - Intergenic
923805458 1:237252382-237252404 TTAGTGTCCCCTCATCAGAGAGG + Intronic
1065774244 10:29104611-29104633 TGGGTGGCCCCTCCTATGGGTGG + Intergenic
1065827791 10:29587670-29587692 TGGGAGTCCTCTGATGAGGTTGG - Intronic
1065950068 10:30643633-30643655 TGGGAGTCCTCTGATGAGGTTGG + Intergenic
1066454479 10:35561125-35561147 TGGGTGTCCCAGAATGAGGGAGG + Intronic
1070693165 10:78542677-78542699 GGGATGTCACCTCAGGAGGGAGG + Intergenic
1070966927 10:80535691-80535713 TGAGTGTCCCTCCATGGGGGTGG - Intergenic
1073083435 10:100873843-100873865 CGGGGGTCCCCTAATGAGAGGGG - Intergenic
1074916078 10:117956370-117956392 TGGGTATGGACTCATGAGGGAGG - Intergenic
1074964643 10:118479544-118479566 TTGGGCTCCCCTCATGATGGAGG + Intergenic
1076346342 10:129781284-129781306 TGGGTATGGCCTCGTGAGGGCGG - Intergenic
1083600645 11:63945484-63945506 TGGGTGTTCCCTCCTTAGGAGGG + Intronic
1087212413 11:95457494-95457516 TGGCTGTCCCCTCCTGAGCCAGG + Intergenic
1087423625 11:97964136-97964158 AGGGTCTCCCCTCCTGAAGGGGG - Intergenic
1089252886 11:117178253-117178275 TGTGTGGCCCCTCTAGAGGGAGG + Intergenic
1096113407 12:49041595-49041617 TGGGTGGCCTCTCTTGAGGGTGG - Intronic
1100341635 12:93684733-93684755 TCAGTGTCCCCTCATCAGAGAGG - Intronic
1101137421 12:101758755-101758777 ACTGTGTCTCCTCATGAGGGAGG + Intronic
1101172092 12:102108172-102108194 TGGGTGTGTCTTCCTGAGGGTGG - Intronic
1102521666 12:113481092-113481114 TGGGTGCTCCCCCACGAGGGAGG - Intergenic
1103949861 12:124544725-124544747 TGGCTGTCCCCTCCTGTGTGTGG - Intronic
1104919625 12:132283751-132283773 CAGGTGTCCCCTCCTGGGGGGGG - Intronic
1105925721 13:25005941-25005963 TGGGAGTCTCCTCTTCAGGGGGG + Intergenic
1106169995 13:27280602-27280624 TGGGTGTCCTGCCATGAGGCTGG + Intergenic
1106182544 13:27381392-27381414 TGGTTGCCCCCACAGGAGGGGGG - Intergenic
1107393139 13:39988143-39988165 TGTGTTACCCCTCATCAGGGAGG - Intergenic
1112171927 13:96982803-96982825 TGGAGCTGCCCTCATGAGGGAGG - Intergenic
1121816976 14:96936077-96936099 TGGGAGTCCCTTCCTCAGGGAGG + Intergenic
1123906791 15:24929553-24929575 TGGGTGTCCCCTCATGAGGGTGG + Intronic
1123929747 15:25159890-25159912 TGAGAGCCCCCTCATGAAGGAGG + Intergenic
1126277033 15:46895396-46895418 TGGGTTTCCCAGCTTGAGGGTGG + Intergenic
1127652599 15:61023712-61023734 TGGGTTTCCTCTCATGTGAGTGG + Intronic
1128785527 15:70394163-70394185 TGGGTCTCCCCTGATGGTGGTGG + Intergenic
1129272720 15:74427945-74427967 TGGGTGACCCCTCATCATGGAGG - Intronic
1130186377 15:81687600-81687622 TGGTTGTATCCTCATGTGGGAGG - Intergenic
1130914111 15:88291250-88291272 TGGAAGTCCTATCATGAGGGAGG + Intergenic
1132309532 15:100847081-100847103 TCGGTGTCCCCTCATGAAGCAGG - Intergenic
1132463849 16:68610-68632 TGGGTGTCTCCTGATGGGGCTGG - Intronic
1132650858 16:1020918-1020940 AGGGTGACCCCTCATCAGGCTGG - Intergenic
1132999216 16:2840809-2840831 TGGGGGTCCACTCAGGAGAGGGG - Intergenic
1134441991 16:14303827-14303849 TGGGTGTTCCCTCAGGGCGGCGG - Intergenic
1136144744 16:28309962-28309984 TGGGTGTCGTTTCATAAGGGTGG + Intronic
1137052106 16:35723122-35723144 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1138418044 16:56882514-56882536 TGGGTGCCTCCTCCTGAGGTGGG - Intronic
1139230999 16:65282120-65282142 TGAGGGACCCCTCAGGAGGGTGG + Intergenic
1139671126 16:68492997-68493019 GGGGTGTGCCCTGAGGAGGGAGG + Intergenic
1141160777 16:81627970-81627992 TGGCTGCACCCTCAGGAGGGCGG + Intronic
1141797583 16:86285576-86285598 TGGGTGTCCACCCAGGAAGGTGG - Intergenic
1142759772 17:2035531-2035553 TGGGGGTCCCGGCAAGAGGGAGG + Intronic
1145257400 17:21334103-21334125 CTGGTGTCCCCTTAAGAGGGAGG - Intergenic
1145319242 17:21753932-21753954 CTGGTGTCCCCTTAAGAGGGAGG + Intergenic
1149635872 17:58168804-58168826 TGGGCGGCCCCTTATGAGTGAGG - Intergenic
1152426586 17:80221427-80221449 TGGGTCTCCCCTCCCCAGGGGGG - Intronic
1152746614 17:82043302-82043324 GGTCTGTCCCCTCCTGAGGGTGG - Intergenic
1159629095 18:70728339-70728361 TGTGTGTCCCCACATGCGGGTGG + Intergenic
1159968785 18:74623373-74623395 TGGGTGTGTGCACATGAGGGCGG + Intronic
1164195897 19:22958537-22958559 AGGGTCTCCACTCCTGAGGGGGG + Intergenic
1165724678 19:38104478-38104500 TGGGTGTCCCCCTAGGTGGGCGG + Intronic
1166504863 19:43364833-43364855 TGTGTGGCCCCTCCTGTGGGTGG + Intergenic
1166505677 19:43370081-43370103 TGTGTGGCCCCTCCTGTGGGTGG - Intergenic
925346935 2:3178289-3178311 TGGGTGCCACATCAGGAGGGTGG + Intergenic
925523598 2:4775568-4775590 AGGGTGTCCTTTCATGAAGGGGG - Intergenic
926204213 2:10823742-10823764 TGAGTGTCCCCTCCTGAAGTGGG - Intronic
927865228 2:26583686-26583708 TGGGTCTCCTCCCAAGAGGGTGG + Intronic
929935825 2:46294127-46294149 AGGGTGTGCCCTCAGGAGGATGG - Intronic
930026208 2:47030578-47030600 TGGGACTCCCCTCTTCAGGGAGG - Intronic
933793687 2:85903674-85903696 TTGGTGTCCCCTCCTGAGGTTGG + Intergenic
939829330 2:147053634-147053656 TGGGTATCCACGCTTGAGGGTGG - Intergenic
942277980 2:174336446-174336468 GGGGTGTCCCCGCAGGAGGCGGG + Exonic
947151099 2:227116272-227116294 TGGGGGTCCTCTCCTGAGGAAGG + Intronic
948347195 2:237308470-237308492 TGAGTGTCCCATCCTGAAGGAGG + Intergenic
948643202 2:239388240-239388262 TGGGTGGACCCGGATGAGGGAGG + Intronic
1171283458 20:23919726-23919748 TGTGTGTGCCCACATGTGGGAGG - Intergenic
1171349102 20:24489150-24489172 TGTGTGTGCCCCCATGAGTGTGG - Intronic
1174374449 20:50116433-50116455 TGGCTCTCCCGTGATGAGGGAGG + Intronic
1175774800 20:61646390-61646412 TGTGTGTCCCTTCAGAAGGGTGG - Intronic
1178493233 21:33067587-33067609 TGGGTGCCCCTTCCTGTGGGTGG + Intergenic
1178894567 21:36548206-36548228 TGGATGGCCTGTCATGAGGGGGG - Intronic
1179249607 21:39661926-39661948 TCAGTGTCCCCTCCTAAGGGAGG - Exonic
1180729133 22:17968323-17968345 TGAGTGTCCCCTCAGTAGGGCGG - Intronic
1182277167 22:29197276-29197298 GGGGTGTCCACTCATGGGTGTGG - Intergenic
1185214911 22:49593280-49593302 TGGGTGTCCTCTCCTGTGGACGG - Intronic
952715561 3:36476442-36476464 TGGGTCACGCCTCTTGAGGGCGG - Intronic
959169525 3:102828378-102828400 TATGTGACCCCTCATGAGAGGGG - Intergenic
960359840 3:116697898-116697920 TGGGTTTCCAGTCTTGAGGGTGG + Intronic
960895895 3:122504690-122504712 TGGTTGTCCCCTCTTGGGGTGGG - Intronic
968967250 4:3775385-3775407 TGGGGACCCCCTTATGAGGGTGG + Intergenic
970046597 4:11861553-11861575 TGGGTATCCAGGCATGAGGGTGG - Intergenic
975116776 4:70688780-70688802 CTGGTGTCCCCTGGTGAGGGTGG - Exonic
985264765 4:188147309-188147331 TGTTTGTCCCCTCATTTGGGAGG - Exonic
1202762282 4_GL000008v2_random:122677-122699 TGGGTGTGTCCTCATCAGTGAGG - Intergenic
987438395 5:17925906-17925928 TTGTGGTCCCCTCATGAGGTTGG - Intergenic
988738366 5:34045044-34045066 GGGGTGTTCCCTCCTCAGGGAGG + Intronic
994000938 5:94778462-94778484 TGGTTGTCCCCTAGGGAGGGGGG - Intronic
995416702 5:111921175-111921197 AGGGTCTCCACTCCTGAGGGAGG - Intronic
995668707 5:114575043-114575065 TGGGAGGTCCCTCATGTGGGCGG + Intergenic
999194736 5:149774227-149774249 ACGGTGTCCCCTCACTAGGGGGG - Intronic
999470221 5:151848616-151848638 TGTGTGACCCCTCATGGGAGCGG + Intronic
1001158907 5:169297206-169297228 TGGGTGTCACCTCCTCATGGAGG + Intronic
1001943125 5:175754627-175754649 TGGGTGTCACCTCTTCAGAGAGG + Intergenic
1002183901 5:177445144-177445166 TGGGTGTCTCCTGATGAGAATGG - Intergenic
1008535018 6:52500950-52500972 TGGGTGTTCTCTAATGGGGGAGG + Exonic
1009610731 6:65937646-65937668 AGGGTCTCCACTCCTGAGGGTGG + Intergenic
1013391461 6:109690377-109690399 TGGGGGTCCCCGCAGGAGGCGGG + Intronic
1014989234 6:128053396-128053418 AGGGTGTCCACGCAAGAGGGTGG - Intronic
1016532843 6:145076836-145076858 TGGGTCTCCAATCTTGAGGGTGG + Intergenic
1017124378 6:151051876-151051898 TGGCTGCGCCCTCCTGAGGGAGG + Intronic
1018608491 6:165623725-165623747 TGAATGCCCACTCATGAGGGAGG - Intronic
1019037358 6:169072730-169072752 AGGGTGTCCCATCGGGAGGGAGG + Intergenic
1023156523 7:37257226-37257248 TTGGAGTTCCATCATGAGGGAGG - Intronic
1023402837 7:39802872-39802894 TGGGTGTGCCCTCAGGAAAGGGG - Intergenic
1024140838 7:46461837-46461859 TAGGTCTCCACTCATGAAGGGGG - Intergenic
1024646791 7:51377765-51377787 TGGGTGTGCCCTCAGGAAAGGGG + Intergenic
1028561477 7:92180336-92180358 GGAGTGTCTCCTCATGAAGGTGG - Intergenic
1036105181 8:5830457-5830479 GGGGTGCCTCCTCATGAGAGAGG + Intergenic
1037050180 8:14362646-14362668 GGGGTGTCGCCTCATCTGGGGGG - Intronic
1037974275 8:23199108-23199130 TGCCTGTCCCCTTGTGAGGGTGG + Intronic
1038430048 8:27492880-27492902 GGGGTGTCCTGTTATGAGGGAGG - Intronic
1040595583 8:48834800-48834822 CGGGTGGCCCCTCATCAGGAGGG + Intergenic
1041826408 8:62100350-62100372 AGGGTTTCCACTCCTGAGGGGGG - Intergenic
1048895098 8:138985150-138985172 TGAGTGGGCCCTCCTGAGGGTGG - Intergenic
1049776414 8:144407886-144407908 TGGGTGTCTCATTGTGAGGGAGG + Intronic
1050298079 9:4227206-4227228 TGGGTGTTCCATCCTGAGGCAGG + Intronic
1061074698 9:128333969-128333991 TGGGTGTCCTCACAGGAGTGAGG + Exonic
1061579863 9:131530275-131530297 TGAGTGTCCCCCCAGGAGCGTGG - Intronic
1061799260 9:133105195-133105217 TGTGTGTCCACGCAGGAGGGGGG + Intronic
1203543046 Un_KI270743v1:107558-107580 TGGGTGTGTCCTCATCAGTGAGG - Intergenic
1189632508 X:42969919-42969941 AGGGTCTCCACTCCTGAGGGGGG - Intergenic
1189974637 X:46448671-46448693 TGGATGTCCCCCCATGGGGCAGG + Intronic
1199143658 X:144339431-144339453 TGGGTTGCCCTTCATGAGGTTGG + Intergenic
1200003829 X:153074885-153074907 TGGGTGTTCCCCCAGGAGGAGGG + Exonic
1201686014 Y:16703121-16703143 TGGGTGGCCCTTCCTGAGGGTGG + Intergenic
1201743870 Y:17350405-17350427 TGGTTGTCCCCTTTTGAGGAGGG - Intergenic