ID: 1123907928

View in Genome Browser
Species Human (GRCh38)
Location 15:24938713-24938735
Sequence GGGGACTCCAAGGGAAACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123907928 Original CRISPR GGGGACTCCAAGGGAAACAC AGG Intronic
900170959 1:1268538-1268560 GGAGACTCCAAGGCACTCACTGG + Intronic
900485842 1:2922282-2922304 GCGGACCCCAAGGGACACACGGG - Intergenic
900755135 1:4429311-4429333 GGGGATTCCAAAGGGCACACAGG - Intergenic
901175830 1:7298372-7298394 GGGGACCCCAGGGGATCCACAGG - Intronic
903070973 1:20726878-20726900 GGGGACCCCAGGGGAAGCACGGG + Intronic
903445233 1:23418720-23418742 GGGGACTTTAAGGGCTACACAGG + Intronic
905023935 1:34837120-34837142 GGGTAGTCCAGGTGAAACACAGG + Intronic
907104563 1:51870535-51870557 GGGAACTCTAAGGGAAATAGTGG - Intronic
908682849 1:66682032-66682054 GTTGACTCCAAGGGAAAAAGTGG + Exonic
909803735 1:79848217-79848239 GGTGAATCCAAGTGAAGCACTGG - Intergenic
912679689 1:111721201-111721223 GGGGAGAGCAAGGGAACCACAGG + Intronic
913496956 1:119436710-119436732 AGAGACTCCAAGAGAGACACTGG + Intergenic
913591791 1:120336048-120336070 GGGAACTCCAAAGAAAACAAAGG + Intergenic
913651565 1:120919098-120919120 GGGAACTCCAAAGAAAACAAAGG - Intergenic
913997174 1:143661063-143661085 GAGGAATCCAAGGGAAGCGCTGG - Intergenic
914169544 1:145209972-145209994 GGGAACTCCAAAGAAAACAAAGG + Intergenic
914505048 1:148281532-148281554 GAGGAATCCAAGGGAAACCCTGG + Intergenic
914505084 1:148281712-148281734 GAGGAGTCCAAGGGAAACTCTGG + Intergenic
914507480 1:148302436-148302458 GAGGAGTCCAAGGGAAACTCTGG - Intergenic
914507516 1:148302616-148302638 GAGGAATCCAAGGGAAACCCTGG - Intergenic
914524656 1:148453934-148453956 GGGAACTCCAAAGAAAACAAAGG + Intergenic
914599014 1:149181899-149181921 GGGAACTCCAAAGAAAACAAAGG - Intergenic
914641744 1:149613201-149613223 GGGAACTCCAAAGAAAACAAAGG - Intergenic
915698520 1:157768726-157768748 GAGAACTCTAAGGGAAACTCTGG + Intronic
916107705 1:161443027-161443049 GGGGTCTCCAGGGGAAGGACCGG - Intergenic
916109289 1:161450400-161450422 GGGGTCTCCAGGGGAAGGACCGG - Intergenic
916110876 1:161457831-161457853 GGGGTCTCCAGGGGAAGGACCGG - Intergenic
916112462 1:161465191-161465213 GGGGTCTCCAGGGGAAGGACCGG - Intergenic
916114047 1:161472608-161472630 GGGGTCTCCAGGGGAAGGACCGG - Intergenic
916975899 1:170077690-170077712 GGCGACTCCAAAGGATACAAAGG - Intronic
917030846 1:170689733-170689755 GGGGAGTGCATGGGATACACAGG + Intronic
919740182 1:200976696-200976718 GGGTACTCCCAGGGCAACAGAGG + Intronic
919827658 1:201515010-201515032 GTGGACTCCAAGGGGCAGACAGG + Intergenic
920567063 1:206982443-206982465 GGGGAATGCAAGGGAACAACAGG + Intergenic
920607206 1:207400713-207400735 GGGGAGTCCAAGTGAAATCCAGG - Intergenic
921177412 1:212607189-212607211 GGGGACTTCAAGTGAGACCCAGG + Intronic
922362873 1:224839198-224839220 GTGGACTCCAAGGAAGTCACAGG - Intergenic
922763417 1:228145950-228145972 CGGGACTGCAAGGGAAACGCTGG + Intronic
924483303 1:244455754-244455776 TGGGACTCCTTGGGAAAAACAGG + Intronic
1063161748 10:3423579-3423601 GGCGGCTCCAGGGGAAGCACGGG + Intergenic
1063956050 10:11268388-11268410 GGGGGCTCCAAGGGAAGGAATGG - Intronic
1064841239 10:19594821-19594843 GGGGACTCAAGGGGAAAGATTGG + Intronic
1067086172 10:43239740-43239762 GGGGTCTCCATGGGAACTACTGG - Intronic
1067186436 10:44032194-44032216 GGAGACACCAAGGAAAACATTGG + Intergenic
1068804795 10:61183334-61183356 GGGGACTCCAAGAGCACCTCAGG + Intergenic
1069517710 10:69092113-69092135 GTGGATTCCAAGGGAAAGAATGG - Intronic
1070524379 10:77282586-77282608 GGTGACATCAAGGGAAACAGAGG + Intronic
1074624904 10:115172147-115172169 AAGGACTGCAAGGGAAACAGTGG - Intronic
1075445929 10:122512855-122512877 GGGGACTCAAGGGGAAAGGCTGG - Intronic
1076144446 10:128106055-128106077 GGGGACTCCAGTGGAGAAACTGG - Exonic
1080337608 11:31216125-31216147 GGAGAATCCCAGAGAAACACTGG + Intronic
1080810677 11:35701295-35701317 TGGGACTCCTTGGGAAAAACAGG - Intronic
1083001541 11:59296851-59296873 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1084934146 11:72578155-72578177 GGGGACATCACAGGAAACACAGG - Intronic
1085420189 11:76351194-76351216 GGAGAATCAAATGGAAACACAGG - Exonic
1087685092 11:101253444-101253466 GGGTACTGGAAGGGAAAAACTGG + Intergenic
1087744241 11:101925036-101925058 GGGGACTTGGAGGGAAACAAAGG - Intronic
1088823788 11:113476949-113476971 AGGGTATACAAGGGAAACACTGG - Intergenic
1089019800 11:115201207-115201229 GGAGACTGCAGGAGAAACACAGG + Intronic
1091191570 11:133699884-133699906 GGTGCCTCCAAGGGAATCAGAGG - Intergenic
1092236755 12:6815245-6815267 GGGGCCTCCAAAGGAGACTCGGG - Intronic
1093459904 12:19398460-19398482 AGGGAGTTCAAGGGAAACACAGG + Intergenic
1094170726 12:27488920-27488942 GGGGCATCCAAGACAAACACAGG - Intronic
1094239899 12:28210568-28210590 TGGGACTCCTTGGGAAAAACAGG - Intronic
1094431335 12:30373116-30373138 GGGGACTCCTTGGGAAAAACAGG - Intergenic
1095561380 12:43570082-43570104 GGAGAATCAAATGGAAACACAGG - Intergenic
1096160764 12:49375011-49375033 GGGATCTCCAAGGGTTACACAGG + Intronic
1096616963 12:52838773-52838795 GGGCACCCCAAGGAACACACTGG + Intronic
1097153216 12:56994627-56994649 GGGGCTCCCAAGGGAAACTCAGG + Exonic
1098281055 12:68863283-68863305 GAGGAGTCCAGGGGAAAGACAGG + Intronic
1100809361 12:98323476-98323498 GGGGACTACTAGGGAGACAGAGG - Intergenic
1102254312 12:111406917-111406939 GGGGATTCCCAGGGAACCCCAGG - Intronic
1107245298 13:38286900-38286922 GGGAACTCCAAGGGAACCTGTGG + Intergenic
1107803394 13:44131533-44131555 GGGGACTCCATAGGAGACTCTGG + Intergenic
1107920672 13:45203481-45203503 GGAGACTGAAAGGGAAGCACAGG - Intronic
1107963790 13:45581121-45581143 GGGGACTGGATGGGAAACATGGG + Intronic
1112367833 13:98770889-98770911 CGGGACTCCAAATGAAATACTGG + Intergenic
1114604854 14:23988456-23988478 GTGGACTCCATGGGGACCACAGG + Intronic
1114610300 14:24036003-24036025 GTGGACTCCATGGGGACCACAGG + Intergenic
1114613837 14:24058087-24058109 GGCGCATCCAAGGGAACCACGGG + Intronic
1116678831 14:47939967-47939989 CTGGACTCCATGGGAAAAACAGG + Intergenic
1119180295 14:72600749-72600771 GGAGACACCAAGGGAGTCACAGG + Intergenic
1120114929 14:80604138-80604160 GGGCACTGTAAGGGAAACATTGG - Intronic
1121948578 14:98147843-98147865 GGGGAGACCAGGGGAACCACAGG + Intergenic
1122323999 14:100871868-100871890 GGGGGCTCCATGGGACACACAGG - Intergenic
1123907928 15:24938713-24938735 GGGGACTCCAAGGGAAACACAGG + Intronic
1123972447 15:25520778-25520800 GGGGACCACAAAGGAAAGACTGG + Intergenic
1126363489 15:47870429-47870451 GGGTTCTCCAAGGGAATCCCAGG + Intergenic
1126588812 15:50318693-50318715 GAGGTCTCCAAGGAAAAGACAGG + Intronic
1127805603 15:62517171-62517193 GGGGACTCCAAGGCACAAAGTGG - Intronic
1128041826 15:64581559-64581581 GGGGCCTTCCAGGGAACCACCGG + Intronic
1131098842 15:89672609-89672631 GTGGTCTCCAAGGCATACACAGG - Intronic
1131735499 15:95327035-95327057 GGGGCCGCCGAGGGAAAGACGGG + Intergenic
1134466556 16:14483993-14484015 TGGGACTCCAGGGGAAGGACAGG - Intronic
1135472377 16:22742849-22742871 CTGTACTCCAAGGAAAACACTGG + Intergenic
1135550305 16:23392537-23392559 GAGGTCACCAAGGAAAACACAGG + Intronic
1135753970 16:25081005-25081027 GGTGAGTCCATGGGTAACACTGG - Intergenic
1137621223 16:49877621-49877643 GGGGTTTCCCAGGGAAACACAGG + Intergenic
1138280261 16:55767638-55767660 AGGGCCTCCACAGGAAACACTGG + Intergenic
1138288226 16:55826000-55826022 AGGGCCTCCACAGGAAACACTGG - Intronic
1140815013 16:78613307-78613329 CGGGACTTCAAGGAACACACTGG - Intronic
1140908237 16:79428434-79428456 TGGGACTCCAAGGGAGCAACAGG - Intergenic
1141722844 16:85766365-85766387 GGGGACCCTAAGGGTGACACTGG + Intergenic
1141778934 16:86143815-86143837 GTGGACTCCAAGAGAAACAATGG - Intergenic
1144357286 17:14458342-14458364 GAGGACCGCAAGGGAAAAACAGG - Intergenic
1144632781 17:16882460-16882482 AGGAACTCACAGGGAAACACTGG - Intergenic
1148492534 17:48032595-48032617 GGGGACTTCAGGAGAAAAACAGG + Intronic
1151725537 17:75881719-75881741 GGGGGCTCCATGGGAAAGGCTGG + Intronic
1151797803 17:76358113-76358135 GGGGACTGCAGGGGAAACGTGGG - Intronic
1155060458 18:22223782-22223804 AAGGAGTCCAAGGGAAACCCAGG + Intergenic
1155072677 18:22329980-22330002 TGGGTCTCCGTGGGAAACACAGG + Intergenic
1157173239 18:45427423-45427445 GTGGTCTTCAAGGGAAACACTGG - Intronic
1158164255 18:54521219-54521241 TAGGACTCAAAGGGAAACCCAGG - Intergenic
1160286694 18:77549593-77549615 GGGAACTCCATGTGAGACACAGG - Intergenic
1160848507 19:1177931-1177953 GGGGATTTCCAGGGAATCACAGG + Intronic
1160879688 19:1313722-1313744 GGGGCCTCCCCGGGGAACACAGG - Intergenic
1162041049 19:7971301-7971323 GGGGGCTCCAAGTGGAGCACAGG + Intronic
1162433473 19:10643112-10643134 GTGGGCTCCGAGGGACACACAGG - Intronic
1165079038 19:33297406-33297428 GGGGCCTCCAAGGCACCCACAGG - Intergenic
1165562761 19:36694821-36694843 GAGGACTCCAAAGGAAGGACTGG + Intronic
1166402564 19:42494204-42494226 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1167533371 19:50032908-50032930 GGGGACACAAAGACAAACACAGG - Intronic
1167828737 19:52000211-52000233 GGGGACTCCAAGAGGAAGAAGGG + Intronic
1168027610 19:53654353-53654375 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1168523399 19:57070330-57070352 GAGGACTGAGAGGGAAACACAGG - Intergenic
1168714445 19:58518826-58518848 TGTGACTCCAAGGGAGAGACAGG - Intronic
925041683 2:735931-735953 GGGGAATCCAGGGGAGTCACTGG - Intergenic
925677454 2:6379216-6379238 GGGGACTCCAAGGGAAAGGGTGG + Intergenic
927096740 2:19753021-19753043 GGGGACTCCACTTGAAACAGGGG - Intergenic
927201282 2:20579537-20579559 GGGGCTTCCAAGGCAAACAATGG - Intronic
928189862 2:29154349-29154371 GGGGACTGGATGGGAAACAAGGG - Intronic
937241172 2:120463562-120463584 GGGGGCTCCAAGGGGCACCCTGG - Intergenic
939070880 2:137540598-137540620 GGGGTGTTCCAGGGAAACACTGG - Intronic
941639588 2:167972750-167972772 TGGGACTCCTTGGGAAAAACAGG + Intronic
942519686 2:176790703-176790725 GGGGACTCCCAGGAATTCACTGG - Intergenic
943961599 2:194271492-194271514 GGGCAATGCAAGTGAAACACAGG - Intergenic
945186659 2:207146581-207146603 GAGATCCCCAAGGGAAACACAGG - Intronic
945274063 2:207970418-207970440 GGGGGCACCCAGGGAAACAATGG + Intronic
947868936 2:233421681-233421703 GGGGACTCCACAGCAAAAACGGG - Intronic
948661611 2:239510383-239510405 TGAGACTCAAAGGGAAAGACGGG - Intergenic
949077543 2:242070673-242070695 GAGGACCCCAAGGGTAACCCTGG + Intergenic
1170556829 20:17521697-17521719 GTGGACCCCAAGGCAAAGACTGG + Intronic
1173497955 20:43532757-43532779 GGGGACTCTAGGGGAAAAAAAGG - Exonic
1175257475 20:57656056-57656078 GGGGACTCCAGGGGAAGAATGGG - Intronic
1179099938 21:38347614-38347636 GGGGACTTTAAGGGAGACAGTGG - Intergenic
1179528608 21:42001955-42001977 GAGGAATCCAAGGGAACCACAGG + Intronic
1179930523 21:44568362-44568384 GGGAACCCCAAAGGAAACGCAGG + Intronic
1180260187 21:46663156-46663178 AGGGACTCTATGGGATACACTGG - Intronic
951578503 3:24137797-24137819 GGGGAGTCAAAGGAAAAAACAGG + Intronic
953435610 3:42874954-42874976 TGGGCCTCCCAGGGGAACACGGG - Exonic
954257150 3:49414876-49414898 AGGGTCTCCAAGGGCATCACTGG + Exonic
954401977 3:50323740-50323762 GGGGACCCCCGGGGAAACAAAGG + Intronic
954642800 3:52111871-52111893 GGAGACACCAAGGATAACACAGG + Intronic
956732822 3:72212398-72212420 CAGCACTCCAAGGGACACACAGG - Intergenic
956812540 3:72878111-72878133 GGGGACAGCAAGGGACACTCAGG - Intergenic
957284262 3:78197272-78197294 TTGGACTCAAAGGGAAACACGGG - Intergenic
957469116 3:80635680-80635702 GGGAAAGACAAGGGAAACACTGG + Intergenic
957471000 3:80657237-80657259 GGGAAGTCCAAGGGAAATAAAGG - Intergenic
961595805 3:128015332-128015354 TGGGACTCCTTGGGAAAAACAGG + Intergenic
963971157 3:151430652-151430674 GGGGACTCCTATGGAATCAAAGG + Intronic
965499068 3:169435481-169435503 GGGGACCCAAAGGGAAGCAGAGG + Intronic
968065012 3:195753720-195753742 GAGGACTCAAAGGGAAAATCAGG + Intronic
968883630 4:3315278-3315300 TGGGAATCCTAGGGAATCACTGG + Intronic
971238037 4:24861472-24861494 GGGGACTCGAAGGGAAGGGCGGG + Intronic
976046394 4:80953240-80953262 GAGGCCTCCAAGGAAAATACAGG - Intronic
977569664 4:98616156-98616178 GGGGAATGCAAGGGAAGCAAGGG - Intronic
978934964 4:114363490-114363512 GGGGACTCAAGGGGAAAGAGTGG - Intergenic
982982553 4:162158279-162158301 TGAGGCACCAAGGGAAACACTGG + Intronic
985084485 4:186298618-186298640 GGGGGCTCCAAGGTGAAGACAGG - Intergenic
986225446 5:5807586-5807608 AGGGATTCCCATGGAAACACAGG - Intergenic
988412148 5:30900125-30900147 GGGGATGGCAAGGGAGACACAGG + Intergenic
989983826 5:50672803-50672825 GGGAACTCCAAAGAAAACAAAGG - Intronic
990849539 5:60187069-60187091 GGGGACTCAAAGGGAAACAAGGG + Intronic
997785895 5:136713244-136713266 TGGGGCTCCAAATGAAACACTGG + Intergenic
997823682 5:137087850-137087872 GTGTAAACCAAGGGAAACACAGG + Intronic
998853952 5:146376972-146376994 GGTGACTCCAAGCTGAACACAGG - Intergenic
1002073445 5:176694363-176694385 GGGGACTCCCAGAGAGAAACTGG + Intergenic
1006981441 6:38151306-38151328 GAGAAATCCAAGGGAGACACTGG - Intronic
1010104069 6:72147530-72147552 TGGGACTCCTTGGGAAACAGAGG - Intronic
1012254802 6:97019391-97019413 GTGGACTCCACAGGGAACACAGG + Intronic
1013426510 6:110017587-110017609 GGGGACCCCAAGGGACAGCCAGG + Intergenic
1015377524 6:132527684-132527706 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1018788324 6:167126473-167126495 GGTGCCACCAAGGCAAACACAGG - Intronic
1018908607 6:168089183-168089205 AGGGACCCCCAGGGAACCACTGG - Intergenic
1021463579 7:20916059-20916081 GTGGACTCAAAGAAAAACACAGG - Intergenic
1022251478 7:28612640-28612662 GGGGTTTCCAAGGAAAACATGGG + Intronic
1023596360 7:41833120-41833142 GAGGTCTCCTAGGGAAATACAGG - Intergenic
1025110749 7:56214112-56214134 GGGGACTCCAAGGGGAAGAGTGG - Intergenic
1028248368 7:88510476-88510498 GGGGACTCAAAGGGAAAGGGTGG - Intergenic
1029551215 7:101237968-101237990 GGGGCCCCCAAGGGAGGCACTGG + Exonic
1029811058 7:103049652-103049674 TGGGACTCCTTGGGAAAAACAGG - Intronic
1031164938 7:118216506-118216528 GGAGTCTCCACGGGAACCACTGG - Intronic
1032752928 7:134860005-134860027 GGGGAAGGCAAGGGAAAAACAGG + Intronic
1033282647 7:140017131-140017153 GGGGCCTGCAAAGCAAACACGGG + Intronic
1035255227 7:157621505-157621527 TAGGACTGAAAGGGAAACACAGG + Exonic
1035578759 8:726205-726227 TGGGACTCCAAGGGAGAGGCAGG + Intronic
1035856616 8:2982691-2982713 GGGAATTAAAAGGGAAACACTGG - Intronic
1039738484 8:40357916-40357938 GGGGACTCCAAGGGAGAGGTAGG + Intergenic
1040286780 8:46104506-46104528 GGGCCTTCCAAGGGAGACACAGG + Intergenic
1041656414 8:60355188-60355210 GGGGTCTTCCAGGGAACCACTGG - Intergenic
1043303164 8:78760471-78760493 GGGGAATCAAATGGAAACACAGG - Intronic
1045272303 8:100672502-100672524 GGTGTCTCCAAAGCAAACACTGG - Intergenic
1046973083 8:120244539-120244561 GGGGACTCCAGGGGAAAGGGTGG - Intronic
1051123632 9:13779013-13779035 TGAGACTCCCAAGGAAACACGGG + Intergenic
1051734908 9:20188248-20188270 GGGAACTCCAAGGAAACCAGGGG - Intergenic
1053581859 9:39413136-39413158 GGGGACTCTAGTGGAAACAGAGG + Intergenic
1053846278 9:42240472-42240494 GGGGACTCTAGTGGAAACAGAGG + Intergenic
1054103438 9:60971868-60971890 GGGGACTCTAGTGGAAACAGAGG + Intergenic
1054582916 9:66934969-66934991 GGGGACTCTAGTGGAAACAGAGG - Intergenic
1055383732 9:75738030-75738052 GGGGACAGCAAGGGACACAGTGG + Intergenic
1057817169 9:98304246-98304268 GGGAACTCCAAGGGAAGAACTGG + Intronic
1058355754 9:104081966-104081988 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1061808205 9:133148171-133148193 GGTGACTCCAAGGGTCCCACAGG - Intronic
1062267307 9:135693083-135693105 GGGGGCTCCAAGGGAAGGGCTGG - Intergenic
1062337541 9:136078886-136078908 GGGGAAGCCAAGGCAAACTCAGG + Intronic
1185500526 X:593761-593783 GGGGGCAGCAAGGGAGACACAGG - Intergenic
1185532335 X:832032-832054 TGGAATTCCAAGGGAACCACAGG + Intergenic
1187478686 X:19634956-19634978 GAGGGCTCCAAGGGGCACACTGG + Intronic
1189385465 X:40533495-40533517 GGGGACTCGAGGGGAAGGACGGG + Intergenic
1190221880 X:48517093-48517115 GGGGAGCCCAGGGGACACACAGG - Intronic
1190663147 X:52673546-52673568 GGGGCCTCCAAGGAAACCCCTGG - Intronic
1190676276 X:52784936-52784958 GGGGCCTCCAAGGAAACCCCTGG + Intronic
1191617244 X:63182421-63182443 TGGGACTCCTTGGGAAAAACAGG + Intergenic
1191619054 X:63196502-63196524 TGGGACTCCTTGGGAAAAACAGG - Intergenic
1192792536 X:74397199-74397221 GGAGAATCAAATGGAAACACAGG - Intergenic
1194131474 X:90087737-90087759 TGGGACTCCATGGGAAAAACAGG - Intergenic
1196042299 X:111218064-111218086 ATGGACTCAAAGAGAAACACAGG - Intronic
1196580669 X:117375489-117375511 GGGGATATCAAGGGAAACAGTGG + Intergenic
1197504469 X:127284436-127284458 GGGGACTCAGGGGGAAACAGTGG + Intergenic
1198936818 X:141907672-141907694 GAGGACTCTCAGGGAAACTCTGG - Exonic
1200166048 X:154036139-154036161 GGGGAGTGCAAGAGAAAAACAGG + Intronic
1201511050 Y:14763451-14763473 TGAGACTCCAAGGGAAGCAAGGG - Intronic