ID: 1123908503

View in Genome Browser
Species Human (GRCh38)
Location 15:24943681-24943703
Sequence AGTTAACTACAGAGGATAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 384
Summary {0: 1, 1: 1, 2: 3, 3: 31, 4: 348}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123908495_1123908503 25 Left 1123908495 15:24943633-24943655 CCACTAATGCCCAGTAGCAGGCC 0: 1
1: 1
2: 18
3: 181
4: 270
Right 1123908503 15:24943681-24943703 AGTTAACTACAGAGGATAGCAGG 0: 1
1: 1
2: 3
3: 31
4: 348
1123908499_1123908503 4 Left 1123908499 15:24943654-24943676 CCAACAGCTGTTTCTCAAAAGGA 0: 2
1: 26
2: 255
3: 284
4: 475
Right 1123908503 15:24943681-24943703 AGTTAACTACAGAGGATAGCAGG 0: 1
1: 1
2: 3
3: 31
4: 348
1123908496_1123908503 16 Left 1123908496 15:24943642-24943664 CCCAGTAGCAGGCCAACAGCTGT 0: 2
1: 21
2: 235
3: 255
4: 379
Right 1123908503 15:24943681-24943703 AGTTAACTACAGAGGATAGCAGG 0: 1
1: 1
2: 3
3: 31
4: 348
1123908497_1123908503 15 Left 1123908497 15:24943643-24943665 CCAGTAGCAGGCCAACAGCTGTT 0: 1
1: 10
2: 54
3: 258
4: 328
Right 1123908503 15:24943681-24943703 AGTTAACTACAGAGGATAGCAGG 0: 1
1: 1
2: 3
3: 31
4: 348

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123908503 Original CRISPR AGTTAACTACAGAGGATAGC AGG Intronic
900434958 1:2625576-2625598 AGTTAACTGCAGAAGATAGCAGG - Intronic
901904052 1:12392686-12392708 AGTTATCTGCAGAAGATGGCAGG + Intronic
903120066 1:21210388-21210410 AGTTATCCACAGAGGATGGTGGG - Intergenic
904179494 1:28655973-28655995 AGTTATCTGCAGAAGATGGCAGG + Intergenic
904335931 1:29797984-29798006 AGTTATCTGCAGAAGATGGCAGG - Intergenic
904769869 1:32874980-32875002 AATTAACTTGAGAGGAAAGCAGG + Intergenic
905065570 1:35178533-35178555 AGGTAAATACAAAGGATTGCAGG - Intronic
905354066 1:37368785-37368807 AGTTATCTGCAGAAGATGGCAGG - Intergenic
909576919 1:77185856-77185878 AGTTATCTGCAGAAGATGGCAGG - Intronic
910370633 1:86512126-86512148 AGTTATCTGCAGAAGATGGCAGG - Intergenic
911109099 1:94164207-94164229 AGTTATCTTCAGAAGATGGCAGG + Intronic
911257327 1:95647366-95647388 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911738399 1:101361921-101361943 AGTTATCTGCAGAAGATGGCAGG + Intergenic
911907224 1:103585871-103585893 GTTTAAGTGCAGAGGATAGCTGG + Intergenic
911980425 1:104559419-104559441 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912129913 1:106588052-106588074 AGTTATCTGCAGAAGATGGCAGG + Intergenic
912212251 1:107568892-107568914 AGTTATCTGCAGAAGATGGCAGG - Intergenic
912252031 1:108021390-108021412 AGTTATCTGCAGAAGATGGCAGG + Intergenic
913039446 1:115008397-115008419 AGTTATCTACAGAAGATAGCAGG + Intergenic
915861707 1:159451282-159451304 AATCAAGAACAGAGGATAGCTGG + Intergenic
917217216 1:172690915-172690937 AGTTATCTGCAGAAGATGGCAGG + Intergenic
917606120 1:176631692-176631714 AGTGAAATACAGATGACAGCGGG + Intronic
918635964 1:186774519-186774541 AGGAAAATACAGAGGAAAGCGGG - Intergenic
918815077 1:189171226-189171248 AGTTACCTGCAGAAGATGGCTGG - Intergenic
918918233 1:190671881-190671903 AGTTATCTGCAGAAGATGGCAGG + Intergenic
919124613 1:193379783-193379805 AGTTATCTACAGAAGATGGCAGG + Intergenic
919274748 1:195399383-195399405 AGTTAAGTCCAGTGTATAGCAGG - Intergenic
919301270 1:195769753-195769775 AGGTGACTGCAGAGGAGAGCAGG - Intergenic
919317970 1:195999360-195999382 AGTTATCTGCAGAAGATGGCAGG - Intergenic
920197429 1:204238364-204238386 AGTTAGCTGCAGAAGATGGCAGG - Intronic
920688150 1:208125702-208125724 AGAAAAGTACAGAGGAAAGCGGG - Intronic
922150122 1:222994454-222994476 AGCTAACTAGAGAGGAGAGATGG - Intronic
923253570 1:232199439-232199461 AGTTATCTGCAGAAGATAGCAGG + Intergenic
923633706 1:235673724-235673746 GGGTAACAATAGAGGATAGCGGG - Intronic
924182508 1:241453247-241453269 AGTTATTTGCAGAAGATAGCAGG + Intergenic
924840778 1:247707834-247707856 AGTTATCTGCAGAAGATGGCAGG + Intergenic
924847135 1:247785140-247785162 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1063734306 10:8734922-8734944 AGTTACCTACAGAGGTGAGATGG + Intergenic
1063960711 10:11303101-11303123 AGTTCGATACAGAGGAGAGCCGG - Intronic
1064194146 10:13231911-13231933 AGTCAACTCCTGTGGATAGCAGG - Intronic
1064545690 10:16448137-16448159 AGTTATCTGCAGAAGATGGCAGG + Intronic
1065005324 10:21374162-21374184 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1065607016 10:27428505-27428527 AGTTATCCACTGAGGATGGCAGG - Intergenic
1066408783 10:35145318-35145340 AGGAAAGTACAGAGGATATCTGG - Intronic
1067026695 10:42848356-42848378 AGTTATCTGCTGAGGATGGCAGG + Intergenic
1067125555 10:43512546-43512568 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1067821491 10:49534937-49534959 AGTTAACAACAGAGCAGGGCAGG + Intronic
1068837218 10:61568380-61568402 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069790833 10:71019585-71019607 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1069851869 10:71410650-71410672 AGTTAACTTCAGAGGATGACGGG - Intronic
1070402548 10:76066218-76066240 ACTTAACTAATTAGGATAGCAGG + Intronic
1071267088 10:83974004-83974026 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071364470 10:84884523-84884545 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1071942787 10:90607780-90607802 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073803844 10:107073718-107073740 AGGTAAATACAGAGGATTGGGGG - Intronic
1073918478 10:108432317-108432339 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1073995875 10:109314719-109314741 AGTTATCTACAGAAGATAATGGG + Intergenic
1074235655 10:111582111-111582133 AGTTATCTATAGAGAATAGCAGG + Intergenic
1076772631 10:132674841-132674863 AGTTACCTGCAGAAGATGGCAGG + Intronic
1076927417 10:133499228-133499250 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1078776982 11:14402875-14402897 AGTTGTCAGCAGAGGATAGCCGG + Intergenic
1080444962 11:32329950-32329972 AGTGAACTACTGAGAATAGTAGG + Intergenic
1080976678 11:37350570-37350592 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1082671698 11:56043014-56043036 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1083093143 11:60221099-60221121 AGTTATCTGCAGAAGATGGCAGG - Intronic
1087137388 11:94734692-94734714 AGTTAACAGCAGAGCAGAGCGGG - Intronic
1087173586 11:95075401-95075423 AGTTAGTTACAGAGGAAAACCGG + Intergenic
1088836653 11:113583361-113583383 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1090221617 11:125031613-125031635 AGTTATCTGCAGAAGATGGCAGG + Intronic
1092093281 12:5821623-5821645 AGTTATCTGCAGAAGATGGCAGG - Intronic
1092381558 12:8000911-8000933 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093036286 12:14335315-14335337 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1093217054 12:16375235-16375257 AGTTAACTATAGAGGGAAGGAGG + Intronic
1093645725 12:21583643-21583665 AGTTATCTGCAGAAGATGGCAGG - Intronic
1094102526 12:26779235-26779257 AGTTATCTGCAGAAGATGGCAGG - Intronic
1095190258 12:39250137-39250159 AGCTATCTACAGAGGATGGCAGG - Intergenic
1095560565 12:43560387-43560409 AGAGAACTACAGAGGCTAGAAGG + Intergenic
1095844402 12:46729995-46730017 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1095856243 12:46863702-46863724 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1096288710 12:50322933-50322955 AGTTATCTACAGAAGATGGCAGG - Intergenic
1096457472 12:51799464-51799486 AGTTATCTGCAGAAGATGGCAGG + Intronic
1097437843 12:59572281-59572303 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1097564650 12:61252456-61252478 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1098673038 12:73254217-73254239 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1098731049 12:74037321-74037343 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1098733288 12:74065604-74065626 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1098831907 12:75374052-75374074 AGTTATCTGCGGAAGATAGCAGG + Intronic
1099183382 12:79492615-79492637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1099526360 12:83723084-83723106 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099689778 12:85938010-85938032 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1099735783 12:86565012-86565034 AGTTATCTGCAGAAGATAGTAGG - Intronic
1099995069 12:89769557-89769579 AGTTATCTGAAGAGGATGGCAGG + Intergenic
1100241155 12:92711635-92711657 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101534670 12:105606131-105606153 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1101543069 12:105682609-105682631 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1101624347 12:106424216-106424238 AGTTAAATCTAGAGGATAGATGG + Intronic
1103035609 12:117654036-117654058 AGTTATCTGCAGAAGATGGCAGG - Intronic
1105740106 13:23315149-23315171 AGTTATCTTCAGAAGATGGCAGG - Intronic
1106007755 13:25787192-25787214 GGTTAACTACAGAGGAGACTGGG - Intronic
1107573259 13:41686462-41686484 ACTTAACCAAAGAGGATAGAGGG - Intronic
1109293221 13:60500091-60500113 AGTTATCCACAGAAGATGGCAGG - Intronic
1109712683 13:66180849-66180871 AGTTTTCTACAGAAGATGGCAGG + Intergenic
1109951026 13:69502232-69502254 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1111116555 13:83786273-83786295 TGTTCACTACAGATGAGAGCTGG + Intergenic
1111317499 13:86581776-86581798 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1111470900 13:88681086-88681108 AGTTATGTACAGATGATGGCAGG + Intergenic
1111535771 13:89600709-89600731 AGTCATCCACAGAGGAGAGCAGG - Intergenic
1112231129 13:97590191-97590213 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1114205868 14:20570742-20570764 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1114228574 14:20760426-20760448 AGTCATCTACATAGTATAGCAGG - Intergenic
1114799187 14:25753317-25753339 AGTGAGCTACAGAGAACAGCTGG + Intergenic
1115143396 14:30199360-30199382 AGTTATCTCCAGAAGATAACAGG - Intergenic
1116531457 14:45978252-45978274 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1117007237 14:51433654-51433676 GGTTACCTACAGAGGGTAGATGG + Intergenic
1117216840 14:53560148-53560170 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1117634130 14:57724346-57724368 AGTTATCTGCAGAAGATGGCAGG - Intronic
1118880777 14:69824045-69824067 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1119555773 14:75551222-75551244 AGATAAATGCAGAGGATGGCAGG - Intergenic
1120082027 14:80227557-80227579 AGTTATCTGCAGAAGATGGCAGG + Intronic
1120231424 14:81845278-81845300 AGTTATCTGCAGAAGATAGCAGG + Intergenic
1121231818 14:92364013-92364035 AGTCACCTACAGAGGATACCAGG - Intronic
1123669584 15:22641902-22641924 AGTTTACTAAAGAGGATAATTGG + Intergenic
1123908503 15:24943681-24943703 AGTTAACTACAGAGGATAGCAGG + Intronic
1124525558 15:30448342-30448364 AGTTTACTAAAGAGGATAATTGG + Intergenic
1124773096 15:32559342-32559364 AGTTTACTAAAGAGGATAATTGG - Intergenic
1127356911 15:58209162-58209184 AGTTATCTGCAGAAGATGGCAGG - Intronic
1127588887 15:60402891-60402913 AGTTCACCACTGAGGAAAGCAGG - Intergenic
1128650408 15:69408090-69408112 TGTTAACTCCAGAAGATATCTGG + Intergenic
1129334348 15:74843356-74843378 AGTTAACAACGGAGGACGGCCGG + Intergenic
1131724007 15:95202768-95202790 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1136250938 16:29004564-29004586 AGTTATCTGCAGAAGATGGCGGG - Intergenic
1138868382 16:60850758-60850780 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1141559546 16:84858065-84858087 AGTTATCTGCAGAAGATGGCAGG + Intronic
1143954215 17:10656222-10656244 AGTTAACTAAAAAGGATAAAGGG + Intronic
1145985617 17:29043985-29044007 AGTCCACTGCAGTGGATAGCTGG - Intronic
1146237981 17:31185921-31185943 AGTTATCTGCAGAAGATGGCAGG - Intronic
1151037814 17:70821615-70821637 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1153028496 18:691983-692005 AGTGAACTGCAGAGGAAAGAAGG + Intronic
1153089704 18:1330131-1330153 AGTTAACTGCAGAAGATGGCAGG - Intergenic
1153217696 18:2835633-2835655 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1154252674 18:12757306-12757328 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1154506169 18:15042859-15042881 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1155940704 18:31799567-31799589 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156582549 18:38394433-38394455 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1156606368 18:38671734-38671756 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1157460807 18:47891395-47891417 CGTTCACTACAGAGGAAAACTGG + Intronic
1158878078 18:61752022-61752044 AGTTCTCTACAGGGGACAGCAGG - Intergenic
1159287787 18:66375451-66375473 AGTTATCTGCAGAAGATAGCAGG - Intergenic
1159559108 18:69975382-69975404 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1164188271 19:22892043-22892065 TTTTAACTTCAGAGGAAAGCAGG + Intergenic
1165255079 19:34572539-34572561 AGTTAACCAAAGAAGATAGAGGG + Intergenic
1166431146 19:42729196-42729218 AGATTACTACAAAGCATAGCGGG - Exonic
1166454044 19:42925846-42925868 AGATTACTACAAAGCATAGCGGG - Exonic
1167951576 19:53031895-53031917 AGTTATCTGCAGAGGATGGTAGG - Intergenic
1168539339 19:57197401-57197423 AGTTATCTGCAGAAGATGGCAGG + Intronic
925321302 2:2971444-2971466 AGTGAATTACAGAACATAGCTGG - Intergenic
930295407 2:49547540-49547562 AGTTACCTGCAGAAGATGGCAGG + Intergenic
931061931 2:58539684-58539706 AGTTAAGTACTGAAAATAGCTGG - Intergenic
931603304 2:64025983-64026005 AGTCAACCACAGAGCATATCTGG + Intergenic
935564312 2:104590282-104590304 AGTTATCTGCAGAAGATGGCAGG + Intergenic
937531189 2:122829577-122829599 ATTTATCTGCAGAGGATGGCAGG - Intergenic
937785210 2:125887757-125887779 AGTTATCTGCAGAGGATGGCAGG + Intergenic
939069058 2:137517827-137517849 AGTTATCTGCAGAAGATGGCAGG - Intronic
939213869 2:139212211-139212233 AGTTATCTGCAGAAGATGGCAGG - Intergenic
939633368 2:144551812-144551834 AGTTATCTGCAGATGATGGCAGG + Intergenic
939755229 2:146101775-146101797 AGTTATCTGCAGAGGAAGGCAGG - Intergenic
939806237 2:146778445-146778467 AGTTATCTGCAGAAGATGGCAGG - Intergenic
941668014 2:168261101-168261123 AGTTATCTGCAGAAGATGGCAGG - Intergenic
943239222 2:185362601-185362623 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943517601 2:188907271-188907293 AGTTATCTGCAGAAGATGGCAGG + Intergenic
943799891 2:192044749-192044771 AGTTATCCACAGAAGATATCAGG - Intronic
945544867 2:211138128-211138150 AGTTATCTGCAGAAGATGGCAGG - Intergenic
945717838 2:213380698-213380720 AGTTATCTGCAGAAGATGGCAGG + Intronic
945725848 2:213471524-213471546 AGTTATCTGCAGAAGATGGCAGG + Intronic
946527871 2:220539996-220540018 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440718 2:230118695-230118717 AGTTATCTGCAGAAGATGGCAGG + Intergenic
947440843 2:230120228-230120250 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1169955411 20:11097518-11097540 AGTTAACTACAGAGTGTGGGTGG + Intergenic
1174973153 20:55300831-55300853 AATCAATTGCAGAGGATAGCAGG - Intergenic
1175601530 20:60277877-60277899 AGTTATCTCCAGAGGACTGCTGG - Intergenic
1176791684 21:13326165-13326187 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177913172 21:27056181-27056203 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1177933700 21:27316962-27316984 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1177991074 21:28037167-28037189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1178060758 21:28851167-28851189 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1180591150 22:16938396-16938418 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1181294904 22:21829571-21829593 AGCTACCTACAGGGGATAGGTGG + Intronic
1181420650 22:22795802-22795824 AGTTATCTGTAGAGGATGGCAGG - Intronic
1182835983 22:33341715-33341737 AGCTAAGTAAAGAGCATAGCTGG - Intronic
1184603564 22:45558404-45558426 AGTTATCTGCAGAAGATGGCAGG + Intronic
949125667 3:443175-443197 AGTTATCTGCAGAAGATGGCAGG + Intergenic
949417595 3:3830912-3830934 AGTTATCTGCAGAAGATGGCAGG + Intronic
949444528 3:4119631-4119653 AGATAACAACACAGGATATCAGG - Intronic
949445608 3:4131024-4131046 AGTTATCTGCAGAAGATGGCAGG - Intronic
951003616 3:17592822-17592844 AGTTATCTACAGAAGATGGCAGG - Intronic
951122567 3:18945537-18945559 AGTTATCTGCAGAAGATGGCAGG - Intergenic
951384522 3:22027505-22027527 AGTTATCTGCAGAAGATGGCAGG - Intronic
951571105 3:24064220-24064242 AGTTAACTGCAGAGTGTGGCAGG + Intergenic
951970766 3:28441895-28441917 AGTTATCTGCAGAAGATGGCAGG + Intronic
952225840 3:31374947-31374969 ACTTGACTAAAGAGAATAGCTGG + Intergenic
955035581 3:55264062-55264084 AGTTATCTGCAGAGGATGGCAGG - Intergenic
956306872 3:67835592-67835614 AGTTATCTGCAGAAGATGGCAGG - Intergenic
956509658 3:69980342-69980364 AGTTATCTGCAGAAGATGGCAGG - Intergenic
957247584 3:77733927-77733949 AGTTATCTGCAGAAGATGGCAGG + Intergenic
957754594 3:84469396-84469418 AGTTATCTGCAGAAGATGGCAGG - Intergenic
958179879 3:90046512-90046534 AGTTATCCACAGAGGATAGCAGG + Intergenic
958487681 3:94732504-94732526 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959203655 3:103279275-103279297 AGTTATCTGCAGAAGATGGCAGG + Intergenic
959746017 3:109777303-109777325 AGTTATCTGCAGAAGATGGCAGG + Intergenic
960826706 3:121793969-121793991 AGGTAACTAAGGATGATAGCAGG + Intronic
961468406 3:127096012-127096034 AGTGAAATGCAGAGGAAAGCAGG - Intergenic
961656489 3:128445299-128445321 TGTTAGCAACAGAGGACAGCAGG - Intergenic
963204004 3:142614310-142614332 ACTTAACTACCAAGGATAGAAGG + Intronic
964679249 3:159318944-159318966 AGTTATCTGCAGAAGATGGCAGG + Intronic
965708648 3:171534809-171534831 AGTTATCTGCAGAGGATGGCAGG + Intergenic
965893161 3:173540124-173540146 AGTCATCTGCAGAGGATGGCAGG + Intronic
966044333 3:175530951-175530973 AGTTATCTGCAGAAGATGGCAGG + Intronic
966445690 3:179998529-179998551 AGTTATCTGCAGAAGATGGCAGG - Intronic
968800180 4:2738091-2738113 AGTTAGCTGCAGAAGATGGCAGG - Intergenic
970523985 4:16913046-16913068 AGTTAACCACAGTGGATGGCAGG - Intergenic
971101014 4:23466452-23466474 AGTTATCTGCAGAAGATAGCAGG + Intergenic
971125928 4:23754310-23754332 AGTTCACTACAGAAGATATATGG - Intergenic
971817226 4:31505045-31505067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
971979298 4:33732903-33732925 AGTTACCTGCAGAAGATGGCAGG + Intergenic
972379751 4:38508351-38508373 AGTTAACTACAGAGCATAAAGGG + Intergenic
972882965 4:43448184-43448206 AGTTATCTGCAGAAGATGGCAGG + Intergenic
973102922 4:46294720-46294742 AGTTATCTGCAGAAGATGGCAGG - Intronic
973118436 4:46489013-46489035 AGTTATCTGCAGAAGATGGCAGG - Intergenic
974289565 4:59912712-59912734 AGTTAACTGTAGAAGATGGCAGG - Intergenic
974564786 4:63568283-63568305 AGTTATCTCCAGAAGATGGCAGG - Intergenic
974746917 4:66088935-66088957 AGTTATCTTCAGAAGATGGCAGG + Intergenic
975024465 4:69531602-69531624 AGTTATCTGCAGAAGATGGCAGG - Intergenic
975386719 4:73767539-73767561 AGTTATCTACAGAAGATGGCAGG + Intergenic
977031619 4:91891377-91891399 AGTTATCTACAGAAGATGGCAGG - Intergenic
977465998 4:97383344-97383366 AGTTATCTGCAGAAGATGGCAGG - Intronic
977626279 4:99192684-99192706 AGTTATCTGCAGAAGATGGCAGG + Intergenic
977701734 4:100029917-100029939 AGTTATCTACAGAAGTTGGCAGG + Intergenic
977930415 4:102743849-102743871 AGTTATCTGCAGAAGATGGCAGG + Intronic
978772155 4:112467810-112467832 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980385790 4:132087061-132087083 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980405894 4:132353821-132353843 AGTTATCTGCAGAAGATGGCAGG + Intergenic
980497528 4:133605392-133605414 AGTTATCTACAGAAGATTACAGG + Intergenic
982597778 4:157407056-157407078 AGTTATCTGCAGAAGATGGCAGG + Intergenic
983027387 4:162755265-162755287 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983185061 4:164691545-164691567 AGTTATCTGCAGAAGATGGCAGG - Intergenic
983582673 4:169324782-169324804 AGTTATCTGCAGAAGATGGCAGG - Intergenic
984060287 4:174982054-174982076 AGTTATCTGCAGAAGATGGCAGG + Intergenic
984238486 4:177190588-177190610 AGTTAATTTCAGTTGATAGCAGG - Intergenic
985432568 4:189895173-189895195 AGTTAATTTGAGAGGAAAGCTGG - Intergenic
986087107 5:4462688-4462710 ATTTATCTGCAGAAGATAGCAGG - Intergenic
986742916 5:10719476-10719498 AGTTATCTGCAGAAGATGGCAGG - Intronic
986808019 5:11327129-11327151 AGTTAACCAGAGAAGACAGCCGG + Intronic
986959836 5:13199189-13199211 AGTTAACTGCAGAAGATGGCAGG - Intergenic
987153171 5:15061636-15061658 AGTTATCTGCAGAAGATGGCAGG - Intergenic
987468192 5:18297014-18297036 AGTTATCTGCAGAAGATGGCAGG + Intergenic
987504385 5:18749824-18749846 AGTTAACTACAGAAGATGACAGG - Intergenic
988056571 5:26105297-26105319 AGTTATCTGCAGAAGATGGCAGG + Intergenic
988107755 5:26772517-26772539 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989097828 5:37797291-37797313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
989457647 5:41661797-41661819 AGTTATCTGCAGAAGATGGCGGG + Intergenic
990786790 5:59430128-59430150 AATTAACCAGAGAGGAAAGCTGG - Intronic
990812280 5:59741764-59741786 AGTAAAATACAGAAGATAACAGG + Intronic
990817245 5:59799265-59799287 AGTTAACTGCAGAGAATGACTGG + Intronic
991013809 5:61910929-61910951 AGTTATCTGCAGAAGATAGCAGG + Intergenic
991272893 5:64806889-64806911 AGTTAACTTCAGAGACTCGCTGG - Intronic
991946143 5:71900111-71900133 AGTTATCTGCAGAAGATGGCAGG - Intergenic
992242952 5:74789838-74789860 AGTTATCTGCAGAAGATGGCAGG - Intronic
993203391 5:84847511-84847533 AGTTATCTGCAGAAGACAGCAGG - Intergenic
993319825 5:86458549-86458571 AGTTATCTGCAGAAGATAGTAGG - Intergenic
993367471 5:87050985-87051007 AGTTATCTGCAGAAGATGGCAGG + Intergenic
993780691 5:92062365-92062387 AGTTATCTGCAGAAGATGGCAGG - Intergenic
994291377 5:98032000-98032022 AGTTATCCACAGAAGATGGCAGG + Intergenic
994855438 5:105113613-105113635 AGTTATCTGCAGAAGATGGCAGG + Intergenic
994984423 5:106915762-106915784 AGTTATCTGCAGAAGATGGCAGG + Intergenic
995079278 5:108028991-108029013 AATCAAATACAGAGGAAAGCAGG + Intronic
995764512 5:115601613-115601635 AGTTTACTACCGTGGAAAGCTGG + Intronic
995945477 5:117639788-117639810 AGCTGACTACAGAGGATGACAGG + Intergenic
996392205 5:122973814-122973836 AGTTATCTGCAGATGATGGCAGG + Intronic
996882171 5:128311820-128311842 AGTTAATTATAGAGAAAAGCTGG - Intronic
999172411 5:149606593-149606615 AGTTACCTACAGAGGGTGGACGG - Intronic
1000416970 5:160993873-160993895 AGTTATCTACAGAAGATGGCAGG - Intergenic
1000621622 5:163492964-163492986 AGTTATCTGCATAGGATAACAGG + Intergenic
1000670162 5:164051600-164051622 AGTGAAACACAGAGGATAGGAGG + Intergenic
1000682731 5:164206185-164206207 AGTTAATTACTGAAGATAGTTGG + Intergenic
1001173592 5:169444614-169444636 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1001838821 5:174855707-174855729 AGTTATTCACAGAAGATAGCAGG - Intergenic
1002997963 6:2304718-2304740 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1005185165 6:23157044-23157066 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006001553 6:30969047-30969069 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1006062349 6:31433194-31433216 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1008079360 6:47178414-47178436 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1008087186 6:47257576-47257598 AATCAACTACAGAGAAAAGCAGG + Intronic
1008266925 6:49439317-49439339 AGTTATCTGCAGAAGATGGCAGG + Intronic
1008400289 6:51055443-51055465 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009806492 6:68606924-68606946 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1009851928 6:69208986-69209008 AGTTATCTGCAGAAGATGGCAGG + Intronic
1010108012 6:72190934-72190956 AGTTATCTGCAGAAGACAGCAGG + Intronic
1010706824 6:79124490-79124512 AATTAACTACAGACAAGAGCAGG + Intergenic
1011039347 6:83013302-83013324 AGTTATCTGCAGAAGATGGCAGG + Intronic
1012344585 6:98170291-98170313 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1012820800 6:104082890-104082912 AGTTATCTGCAGAAGATGGCCGG - Intergenic
1012920797 6:105219573-105219595 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1014534200 6:122596658-122596680 AGTTATCTGCAGAAGATGGCAGG + Intronic
1015475746 6:133657463-133657485 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016144287 6:140649374-140649396 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1016567803 6:145476187-145476209 AGTTGACTACATAGGATAAAAGG + Intergenic
1017977121 6:159368085-159368107 AGTTATCTGCAGAAGATGGCTGG + Intergenic
1018803795 6:167243019-167243041 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1020710346 7:11597597-11597619 AGTTATCTGCAGAAGATGGCAGG - Intronic
1022562814 7:31367399-31367421 CTTTAACTACAGATGATTGCTGG - Intergenic
1024040534 7:45550116-45550138 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1024374734 7:48624105-48624127 AGTTAATAACAGAGGAGAGCTGG + Intronic
1028141732 7:87281955-87281977 AGTTATCTTCAGAAGATGGCAGG - Intergenic
1030277455 7:107736085-107736107 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1030359624 7:108580837-108580859 AGTTAATTACAGAGTCTTGCTGG + Intergenic
1030406818 7:109125364-109125386 AGAAAACTACAGAAGATAGATGG - Intergenic
1032153107 7:129446987-129447009 AGTTATCTGCAGAAGATGGCAGG + Intronic
1032399888 7:131617345-131617367 AGTTCAGAACAGAGGAGAGCAGG + Intergenic
1032744552 7:134772552-134772574 AATTAGATTCAGAGGATAGCAGG - Intronic
1036016754 8:4793967-4793989 AGTTAACTACAAAGGCTTACAGG + Intronic
1036055764 8:5252124-5252146 AGTGAACTCCAGTGGACAGCTGG - Intergenic
1036527350 8:9547549-9547571 AGTTATCCACAGAGGATGGCAGG + Intergenic
1037364596 8:18108298-18108320 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1039292313 8:36109912-36109934 AGTTATCTACAGAGGATAGCAGG + Intergenic
1040663674 8:49604780-49604802 AATTAACTTCAGAGGACAGTTGG + Intergenic
1042001067 8:64124026-64124048 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042085615 8:65105668-65105690 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1042147247 8:65742938-65742960 AGTTAACTACTGTGGACTGCTGG + Intronic
1044150798 8:88773045-88773067 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1045221835 8:100207037-100207059 AGTTATCTGCAGAAGATGGCAGG - Intronic
1045978892 8:108160943-108160965 AGTTGACTACAGAGAAGATCAGG + Intergenic
1046247812 8:111589271-111589293 AGGTAAGTAGAGAGGAAAGCAGG + Intergenic
1047262137 8:123273456-123273478 AGTTAATTAAAGAGGATGGTAGG - Intronic
1047886555 8:129256885-129256907 AAGTAACTACAGAGACTAGCTGG - Intergenic
1047979099 8:130161553-130161575 AGTTACCTACACAAGAGAGCAGG - Intronic
1048237084 8:132701436-132701458 AGTGAAGTACAGAGGATGCCTGG + Intronic
1050482671 9:6102573-6102595 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1051882143 9:21850632-21850654 AGTTATCTGCAGAAGATGGCAGG - Intronic
1051966460 9:22834547-22834569 AGTTACCTGCAGAAGATGGCAGG - Intergenic
1052069243 9:24061237-24061259 AGTTAAGTAAAGAGAAAAGCAGG + Intergenic
1052474837 9:28945684-28945706 TTTTAAATACAGAGGGTAGCAGG - Intergenic
1053721755 9:40953385-40953407 AGTTAATTTGAGAGGAAAGCTGG - Intergenic
1054344206 9:63898604-63898626 AGTTAATTTGAGAGGAAAGCTGG + Intergenic
1055147013 9:72948141-72948163 AATTAAATACATAGAATAGCTGG + Intronic
1055519752 9:77068783-77068805 AATTAATAACAGAAGATAGCTGG - Intergenic
1055798614 9:80005167-80005189 AGTTACCTACAGCAGGTAGCAGG + Intergenic
1055903944 9:81271234-81271256 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1056006238 9:82274557-82274579 AGTTAACTAGAGAAGAGAGGAGG - Intergenic
1056156662 9:83845179-83845201 AGTTAGCTGCAGAAGATGGCGGG - Intronic
1056353876 9:85778348-85778370 AGTTATCTGCAGAAGATGGCGGG + Intergenic
1058019893 9:100076050-100076072 AGTTATCTGCAGAAGATGGCAGG - Intronic
1058259260 9:102809698-102809720 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1059784273 9:117563552-117563574 AGTGAACTCCAGAGGAATGCAGG + Intergenic
1062135467 9:134924993-134925015 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1203453406 Un_GL000219v1:142615-142637 AGTTAATTTGAGAGGAAAGCTGG + Intergenic
1186279492 X:7977088-7977110 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1186384097 X:9091792-9091814 AGTTATCTGCAGAAGATGGCAGG + Intronic
1186523709 X:10228569-10228591 AGTAAAATACAGAGGATATGGGG + Intronic
1187604862 X:20871832-20871854 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1188759932 X:34014608-34014630 AGTTACATACAGAGGATTTCAGG + Intergenic
1190255269 X:48757773-48757795 AGTTATCTGCAGAGAATAGCAGG - Intergenic
1190996751 X:55617499-55617521 AGTTATCTACAGAAGATGGCAGG + Intergenic
1191607366 X:63077503-63077525 AATTAACTACAGATGATGCCAGG + Intergenic
1191719244 X:64215740-64215762 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1191759358 X:64629893-64629915 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1191932924 X:66394130-66394152 AGTTATCTGCAGAAGACAGCAGG - Intergenic
1192106204 X:68319974-68319996 ATTTAACTGCAGAGGATATGTGG + Intronic
1192297714 X:69868047-69868069 AGTTATCTGCAGAAGATGGCAGG + Intronic
1192531689 X:71893168-71893190 AGTTATCTGCAGAGGATGGTAGG + Intergenic
1192898700 X:75471878-75471900 AGTTATCTGCAGAAGATGGCAGG - Intronic
1192996189 X:76515546-76515568 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1193904483 X:87225799-87225821 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194210275 X:91062322-91062344 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1194849249 X:98852206-98852228 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1196135972 X:112209875-112209897 AGTTATCTGCAGAAGATGGCAGG + Intergenic
1197245049 X:124159026-124159048 AGTTATCTGCAGAAGATGGCAGG + Intronic
1197372060 X:125637898-125637920 AGTTACCTGCAGAAGATGGCAGG + Intergenic
1197534714 X:127673447-127673469 AGCTAACCACAGAGAATGGCAGG - Intergenic
1198406830 X:136321479-136321501 AGAACACTACAGAGGCTAGCAGG - Intronic
1198897161 X:141468332-141468354 ATTCAACTACAGTGGAGAGCAGG + Intergenic
1199008504 X:142730855-142730877 AGTTATCTCCAGAGGATGGCAGG - Intergenic
1199040588 X:143111068-143111090 AGTTATCTGCAGAAGATGGCAGG - Intergenic
1200746061 Y:6904904-6904926 AGTTACCCACAGAAGATGGCAGG + Intergenic
1200973127 Y:9177742-9177764 ATTTATCTACAGAAGATGGCAGG + Intergenic