ID: 1123909338

View in Genome Browser
Species Human (GRCh38)
Location 15:24951182-24951204
Sequence CTGCTTAGGAGTAGAATTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 886
Summary {0: 1, 1: 0, 2: 12, 3: 118, 4: 755}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123909336_1123909338 -2 Left 1123909336 15:24951161-24951183 CCGTTTTCATTTCTTTGTGATCT 0: 1
1: 1
2: 10
3: 118
4: 1497
Right 1123909338 15:24951182-24951204 CTGCTTAGGAGTAGAATTGTAGG 0: 1
1: 0
2: 12
3: 118
4: 755
1123909333_1123909338 11 Left 1123909333 15:24951148-24951170 CCACCGTGCCTGGCCGTTTTCAT 0: 1
1: 4
2: 115
3: 1252
4: 6899
Right 1123909338 15:24951182-24951204 CTGCTTAGGAGTAGAATTGTAGG 0: 1
1: 0
2: 12
3: 118
4: 755
1123909335_1123909338 3 Left 1123909335 15:24951156-24951178 CCTGGCCGTTTTCATTTCTTTGT 0: 1
1: 1
2: 3
3: 91
4: 900
Right 1123909338 15:24951182-24951204 CTGCTTAGGAGTAGAATTGTAGG 0: 1
1: 0
2: 12
3: 118
4: 755
1123909334_1123909338 8 Left 1123909334 15:24951151-24951173 CCGTGCCTGGCCGTTTTCATTTC 0: 1
1: 0
2: 17
3: 188
4: 1888
Right 1123909338 15:24951182-24951204 CTGCTTAGGAGTAGAATTGTAGG 0: 1
1: 0
2: 12
3: 118
4: 755

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123909338 Original CRISPR CTGCTTAGGAGTAGAATTGT AGG Intronic
900277573 1:1841830-1841852 ATACCTAGGAGTAGAATTGCTGG - Intronic
901378028 1:8853785-8853807 ATACCTATGAGTAGAATTGTTGG - Intergenic
901623397 1:10607399-10607421 GCGCCTAGAAGTAGAATTGTTGG + Intronic
901676096 1:10886246-10886268 ATACCTAGGAGTAGAATTGTTGG - Intergenic
901731309 1:11282100-11282122 ATGCCCAGGAGTAGAATTGCTGG + Intronic
902231935 1:15033429-15033451 ATGCCTAGGAGTAGAATCGCAGG + Intronic
902972676 1:20065790-20065812 ATACTTAGGAGTACAATTGCTGG + Intronic
903432211 1:23314817-23314839 ATTCTTAGGGGTAGAATTGTGGG - Intronic
903955912 1:27025472-27025494 ATACTCAGGAGTAGAAATGTTGG + Intergenic
904068007 1:27770114-27770136 ATAGTTAGGAGTAGAATTGCTGG + Intergenic
904289712 1:29476642-29476664 ATAGTTAGGAGTAAAATTGTTGG + Intergenic
905379593 1:37551864-37551886 ATGCTCAGGAGTACAATTGCTGG - Intronic
905747543 1:40431673-40431695 ATACCTATGAGTAGAATTGTTGG - Intergenic
905762673 1:40573245-40573267 ATGCTTAGGAGTGGAGTTGCTGG - Intergenic
906376694 1:45302371-45302393 TTTCTTGGAAGTAGAATTGTTGG - Intronic
906959615 1:50410643-50410665 ATACTTAGGAGTGGAATTGCTGG - Intergenic
906997976 1:50818382-50818404 ATTCTTAAGAGTGGAATTGTGGG - Intronic
907204041 1:52753234-52753256 ATACTTAGGAGTAGAATTGCTGG + Intronic
907551311 1:55307509-55307531 ATTTTTAGGAGTGGAATTGTTGG + Intergenic
908039595 1:60094854-60094876 ATGCTTAGGAGCTGAATTGCTGG + Intergenic
908448521 1:64225993-64226015 ATACTTAGGAGTAGAATTACTGG - Intronic
909225335 1:73013447-73013469 ATACCTAGGAGTAGAATTGTAGG + Intergenic
909511660 1:76459997-76460019 ATACTTAGGAGTAGAATTGATGG + Intronic
909631058 1:77770367-77770389 TTACCTAGGAGTAGAATTGCTGG + Intergenic
909699476 1:78506047-78506069 ATGACTAGGAGTGGAATTGTTGG + Intronic
910634941 1:89397231-89397253 ATGCTCAGCAGTAGAATTGCTGG + Intergenic
910681251 1:89867623-89867645 CTGCCTAGGAGTGGAATTGAAGG + Intronic
910921532 1:92353204-92353226 ATACCTAGGAGTAGAATTGCTGG + Intronic
910937962 1:92502028-92502050 ATACCTAGGAGTAGAATTGCTGG - Intergenic
910949127 1:92626534-92626556 ATACTTAGGAGTAGAACTGCTGG + Intronic
910976474 1:92911673-92911695 ATGCTCAGGAGTATAATTGCTGG + Intronic
911004718 1:93208125-93208147 ATACCTAGGAGTAGAATTCTTGG + Intronic
911073713 1:93852499-93852521 ATGCCTAGGAGTGGAATTGCTGG - Intergenic
911155411 1:94631587-94631609 ATACCTAGGAGTAGAATTGCTGG + Intergenic
911308732 1:96266208-96266230 CTGCCTAGGAGTGGAATAGCTGG - Intergenic
911385891 1:97175071-97175093 ATACCTAGAAGTAGAATTGTTGG + Intronic
911436299 1:97863394-97863416 CTTCCTAGAAGTGGAATTGTTGG - Intronic
911534300 1:99081431-99081453 ATGCTTAGGAGTACAATGATTGG - Intergenic
911671997 1:100618179-100618201 ATGCCTAGCAGTAGAATTGCTGG + Intergenic
911781855 1:101889881-101889903 CTTCTGAGAAGTAGAATTATAGG - Intronic
912065919 1:105742747-105742769 ATGCTTAGGAGTAGATTGTTGGG - Intergenic
912599561 1:110914929-110914951 ATACTTAGGAATGGAATTGTTGG - Intergenic
912760520 1:112362267-112362289 ATACCTAGGAGTGGAATTGTTGG - Intergenic
912854240 1:113153040-113153062 CTACCTAGGAGTGGAATTGCTGG + Intergenic
912902219 1:113663711-113663733 ATACCTAGGAGTGGAATTGTTGG + Intronic
913399446 1:118413103-118413125 CTACTCAGGAGTGGAATTGCTGG + Intergenic
913458309 1:119056889-119056911 ATACCTAGGAGTAGAATTGCTGG + Intronic
914412275 1:147441934-147441956 ATTCCTAGGAGTAGAATTGCTGG + Intergenic
916514658 1:165504685-165504707 ATACCTAGGAGTGGAATTGTTGG - Intergenic
916598000 1:166264296-166264318 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
916629080 1:166592522-166592544 CTGCTTAGCAGTAGCACTGAAGG + Intergenic
916643491 1:166757876-166757898 ATACTCAGGAGTAGAATTGCTGG + Intergenic
916704862 1:167338925-167338947 ATACCTAGGAGTAGAATTGCTGG + Intronic
917129621 1:171727571-171727593 ATACCTAGGAGTAGAATGGTTGG - Intronic
917301898 1:173583981-173584003 ATACCTAGGAGTAGAATTGCTGG - Intronic
917546075 1:175969347-175969369 CTGCTTCAGAGGAGAAGTGTGGG - Intronic
917718993 1:177768081-177768103 TTGCTTAGGAGTAAGATAGTGGG - Intergenic
917992152 1:180391782-180391804 ATACCTAGGAGTAGAATTGCTGG - Intronic
918282051 1:183016487-183016509 ATACCTAGGAGTGGAATTGTTGG - Intergenic
918845234 1:189601121-189601143 CTGCTTAAAACTAGAATTTTTGG - Intergenic
919303519 1:195800605-195800627 ATACCTAGGAGTGGAATTGTTGG - Intergenic
920058389 1:203210385-203210407 ATGCCTAGGAGTAGAATTAATGG - Intergenic
920151894 1:203916863-203916885 CTACTTAGGAGTAGAATTTTTGG + Intergenic
920268915 1:204748134-204748156 AAGCTTAGAAGTAGGATTGTAGG - Intergenic
920625825 1:207597726-207597748 ATGCCTAGGAGCAGAATTGCTGG - Intronic
920664507 1:207952079-207952101 CTGCCTAGGAGTGGAATTGCTGG + Intergenic
920754088 1:208711390-208711412 ATGCCAAGGAGTAGAATTGCTGG + Intergenic
920897121 1:210064775-210064797 ATACCTAGGAATAGAATTGTAGG + Intronic
921404749 1:214766166-214766188 ATACCTAGGAGTAGAATTGCTGG + Intergenic
921739445 1:218667166-218667188 GTTCTTAGAAGCAGAATTGTGGG - Intergenic
922394865 1:225187503-225187525 ATACCTAGGAATAGAATTGTTGG + Intronic
923059652 1:230459169-230459191 ATACTTAGGAGTGGAATTGCTGG + Intergenic
923212416 1:231815980-231816002 ATGCCTGGAAGTAGAATTGTTGG + Intronic
923357193 1:233170165-233170187 GTACCTAGGAGTAGAATTGCTGG + Intronic
923691093 1:236193385-236193407 ATTCTTAGGAGTGGAATTGCTGG + Intronic
923732834 1:236569761-236569783 ATACCTAGGAGTGGAATTGTTGG - Intronic
923895509 1:238265288-238265310 ATACTTAGGAGTGGAATTGCTGG - Intergenic
923951290 1:238957809-238957831 ATGCATAGAAGTAGAATTGCTGG - Intergenic
1063557537 10:7095222-7095244 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1063829678 10:9937615-9937637 ATGCCTAGGAGTGAAATTGTTGG + Intergenic
1064067517 10:12195484-12195506 CTGCAGAGGAGTAGAATGCTTGG - Intronic
1064772636 10:18739629-18739651 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1065093554 10:22259368-22259390 CTTCTTAGGATTAGATTTCTGGG + Intergenic
1065793781 10:29286471-29286493 ATACATAGGAGTATAATTGTCGG + Intergenic
1066378520 10:34881473-34881495 ATGCCTAGGAGTGGAATTGCTGG - Intergenic
1067340609 10:45400116-45400138 AGGCCTAGGAGTAGAATTGCTGG - Intronic
1068100950 10:52552211-52552233 ATACTTAGTAGTAGGATTGTTGG + Intergenic
1068105374 10:52608277-52608299 ATGCCTAGGGGTAGAATTGCTGG - Intergenic
1068503849 10:57874228-57874250 CCTCTGAGGAGTGGAATTGTTGG - Intergenic
1068994631 10:63189079-63189101 CTCCTTAGGAATAGAAATGGAGG - Intronic
1069683575 10:70301770-70301792 CTACCTAGGAGTAAAATTGCTGG - Intronic
1069783539 10:70973310-70973332 ATATTTAGGAGTAGGATTGTTGG - Intergenic
1069970422 10:72163249-72163271 ATACCTAGGAGTAGAATTGCTGG - Intronic
1070044871 10:72822993-72823015 CTATCTAGGAGTAGAATTGTGGG - Intronic
1070113463 10:73506868-73506890 CTTCTCAGGATTAGAATCGTTGG - Intronic
1070359621 10:75674749-75674771 CTGCAGAGTAGCAGAATTGTTGG + Intronic
1070518496 10:77229926-77229948 ATGCATAGGAGTGGAATTGCAGG - Intronic
1070937474 10:80312344-80312366 ATGCATAGGAGTAAAATTGCTGG - Intergenic
1071015404 10:80991219-80991241 ATACTTAGGAGTAGGATTGCTGG + Intergenic
1071038656 10:81279643-81279665 ATGCTTAGGAGTGGAATTGCTGG - Intergenic
1071410774 10:85392445-85392467 ATGCTTAGGATGAGAATTGCTGG - Intergenic
1072212046 10:93255030-93255052 ATTCCTAGGAGTAGAATTGCTGG - Intergenic
1072455279 10:95570000-95570022 ATACCTAGGAGTAGAGTTGTTGG + Intergenic
1072816438 10:98513884-98513906 ATGCCTAGGAGTGGAATTGCTGG - Intronic
1072820203 10:98549114-98549136 CTGCTTAGGAGTAGAAATTCTGG + Intronic
1073031755 10:100531879-100531901 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1073311427 10:102545457-102545479 ATACTTAGGAGTGGAATTGCTGG + Intronic
1074346380 10:112690272-112690294 ATACTTAGGAGTAGGATTGATGG + Intronic
1074349340 10:112720222-112720244 CTACTTAGGAGTAGAATTGCTGG + Intronic
1074594599 10:114850117-114850139 ATGCTTAGTAGTAAAATTGATGG + Intronic
1075084293 10:119404034-119404056 ATACATAGGAGTAGAATTGCTGG + Intronic
1075229043 10:120656691-120656713 ATGCCTAGGAGTAGAATGGCTGG + Intergenic
1075301427 10:121328078-121328100 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1075863011 10:125693813-125693835 ATTCTCAGGAGTAGAATTGCTGG - Intergenic
1076213638 10:128674251-128674273 GTGCCAAGGAGTAGAATTGCTGG - Intergenic
1076311749 10:129512880-129512902 GTCCTTAGGGGTAGAATTGCTGG - Intronic
1076637494 10:131891868-131891890 CTGGAGGGGAGTAGAATTGTGGG - Intergenic
1077124891 11:928842-928864 CTGCCCAGGAGGAGAATGGTGGG - Intronic
1078126942 11:8575229-8575251 ATACCTAGGAGTAGAATTGCTGG - Intronic
1078206283 11:9232700-9232722 ATGCTCAGGAGTGGAATTGCTGG - Intronic
1078585276 11:12580517-12580539 ATACATAGGAGTGGAATTGTTGG - Intergenic
1078620918 11:12907011-12907033 CTACCTAGGAGTGGAATTGCTGG + Intronic
1078695891 11:13631171-13631193 ATACTTAGAAGTGGAATTGTTGG + Intergenic
1078788731 11:14522383-14522405 ATTCATAGAAGTAGAATTGTGGG + Intronic
1079274477 11:19021702-19021724 CTGCTTAGGTGTGAAATTGCTGG + Intergenic
1079705346 11:23609557-23609579 TTTCTTAGGAGTATAATTATGGG - Intergenic
1079937471 11:26635516-26635538 CTGCCCAGGAGTAGTATTGTTGG + Intronic
1080057449 11:27920928-27920950 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1080880720 11:36317586-36317608 ATGCCTAGGAGTAGAATTGTTGG + Intronic
1081092981 11:38896020-38896042 CTGCTTTCCAATAGAATTGTGGG - Intergenic
1081281639 11:41215867-41215889 ATGCTTAGGAGTAGAATGCCTGG + Intronic
1082892034 11:58149979-58150001 CTACTTAAAAGTGGAATTGTTGG + Intronic
1083403061 11:62437675-62437697 ATACTTAGGAGTAGAATTTCTGG + Intronic
1083559382 11:63660543-63660565 ATACCTAGGAGTAGAATTGCTGG - Intronic
1083945951 11:65922776-65922798 CTACCTAGGAGTGGAATTGCTGG - Intergenic
1084338139 11:68473910-68473932 ATACGTAGGAGTGGAATTGTTGG + Intronic
1084340439 11:68495843-68495865 ATACCTAGGAGTAGAATTGTTGG + Intronic
1084885001 11:72198110-72198132 CTGCTTAGGAGTCGAAGTTTGGG - Intergenic
1084896529 11:72275066-72275088 TAACCTAGGAGTAGAATTGTTGG + Intergenic
1085139309 11:74126144-74126166 TTGATTAGGAGTGGAATTTTAGG + Intronic
1085366904 11:75956267-75956289 ATACCTAGGAGTAGAATTGCTGG + Intronic
1085496202 11:76972132-76972154 ATACTTAGGAGTGGAATTGCTGG + Intronic
1085557095 11:77434118-77434140 ATATTTAGGAGTAGAATTGCAGG - Intronic
1086101559 11:83105415-83105437 ATTCCTAGGAGTAGAATTGCTGG + Intergenic
1086778523 11:90872182-90872204 CTACTTAGGAGTAGAGTTGCTGG - Intergenic
1086996491 11:93362677-93362699 ATACCTAGGAGTGGAATTGTTGG - Intronic
1087250674 11:95895733-95895755 ATTTTTAGGAGTAGAATTGCTGG - Intronic
1087410785 11:97788023-97788045 ATACCTAGGAGTGGAATTGTTGG + Intergenic
1087578358 11:100019699-100019721 ATACTCAGAAGTAGAATTGTTGG + Intronic
1087673441 11:101131600-101131622 ATGCATAGGAGTGGAATTGCTGG + Intergenic
1087995528 11:104802837-104802859 ATGTCTAGGAGTAGAATTGCTGG - Intergenic
1088168765 11:106970700-106970722 ATACTTAGGAGTGCAATTGTTGG - Intronic
1088520670 11:110695797-110695819 GTACCTAGGAGTAGAATTGCAGG - Intronic
1088741481 11:112770890-112770912 ATGCCTAGGAGTGGAATTGTCGG - Intergenic
1088943624 11:114486003-114486025 ATGCTTAGCAGTGGAATTGCTGG + Intergenic
1089325468 11:117653685-117653707 ATGCCTAGGAGTAGAATGGCTGG - Intronic
1089446113 11:118553636-118553658 ATACATAGGAGTAGAATTGCTGG - Intronic
1089580596 11:119479725-119479747 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1091067269 11:132527242-132527264 ATGCCTAGGAGTGGAATTGCTGG + Intronic
1091179747 11:133593390-133593412 CTGCCTATGAGTAGAATGGCTGG + Intergenic
1091651659 12:2314829-2314851 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1091989716 12:4945516-4945538 GTTCTTAGGAGTGGAATTGCTGG + Intergenic
1092082599 12:5729638-5729660 ATACGTAGGAGTAGAATTGCTGG - Intronic
1092383808 12:8019829-8019851 ATACCTAGGAGTGGAATTGTTGG - Intergenic
1093226942 12:16496128-16496150 ATGCCTAGGAGCAGAATTGCTGG - Intronic
1093776350 12:23079332-23079354 ATGCCTAGGAGTAGAATTCTAGG - Intergenic
1093804346 12:23413826-23413848 CTGTTTAGGAATAGAATATTCGG - Intergenic
1094078734 12:26508874-26508896 ATACTTAGGAGTGGAATTGCCGG - Intronic
1094118824 12:26947146-26947168 GTACCTAGGAGTGGAATTGTTGG + Intronic
1094282806 12:28759058-28759080 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
1094389248 12:29931676-29931698 CTGCTTACGAGTTGACTGGTAGG + Intergenic
1094784875 12:33836318-33836340 ATACTTAGGAGTAGAATTGCTGG - Intergenic
1095416510 12:41983095-41983117 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1096218643 12:49813159-49813181 ATACTTAGGAGTAGAATTGCTGG + Intronic
1096285281 12:50294486-50294508 CTACTTAGGAGTGGGATTGCTGG + Intergenic
1097202342 12:57289868-57289890 CTGATTAGGGGTGGAGTTGTGGG - Intronic
1097340709 12:58434657-58434679 ATCCTTAGGAGTGGAATTGCTGG + Intergenic
1097752637 12:63374261-63374283 ATGCCTAGGAGTTGAATTGCTGG - Intergenic
1097761671 12:63473071-63473093 ATTCCTAGGAGTGGAATTGTTGG + Intergenic
1098197864 12:68021034-68021056 CCACTTAGGAGGAGAATTTTGGG - Intergenic
1098363336 12:69676927-69676949 CTGCATAGAAGAAGAATTGTAGG + Exonic
1098366501 12:69708999-69709021 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1098785941 12:74755799-74755821 GTACCTAGGAGTAGAATTGCTGG + Intergenic
1098798954 12:74928578-74928600 ATGTTCAGAAGTAGAATTGTTGG - Intergenic
1098826398 12:75303003-75303025 ATACTTAGAAGTAGAATTGTTGG - Intronic
1099770788 12:87052492-87052514 ATACTTAAGAATAGAATTGTTGG - Intergenic
1099783253 12:87228054-87228076 GTACTTAGGAGTGGAATTGCTGG + Intergenic
1099964012 12:89425878-89425900 ATACGTAGGAGTAGAATTGCTGG - Intronic
1099974774 12:89534815-89534837 CTACCTAGGAGTGGAATTGCTGG - Intergenic
1100622122 12:96287534-96287556 ATACCTAGGAGTAGAATTGCTGG - Intronic
1100681199 12:96923373-96923395 ATACTTAGGAGTGGAATTGCAGG + Intronic
1101053697 12:100890401-100890423 CTTCCTAGAAGTAGAATTCTTGG + Intronic
1102136034 12:110576357-110576379 ATACCTAGGAGTAGAATTGCTGG - Intronic
1102268049 12:111505820-111505842 CTACCTAGGAGTTGAATTGCTGG - Intronic
1102641019 12:114366617-114366639 CTGCTGAGGTATAGAACTGTTGG - Intronic
1102654892 12:114474234-114474256 ATGCCTAGAAGTAGAATTGCTGG + Intergenic
1102959451 12:117083067-117083089 TTGTTTTGGAGTAGAATTGCTGG - Intronic
1103052339 12:117791061-117791083 CTGATTAGGGAGAGAATTGTAGG - Intronic
1103150217 12:118631552-118631574 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1103359284 12:120344264-120344286 ATGCCTAGAAGTGGAATTGTTGG + Intronic
1103677303 12:122666146-122666168 TTTCCTAGGAGTAGAATTGCCGG + Intergenic
1103795100 12:123497898-123497920 GTGCCTAGGAGTGGAATTGCTGG + Intronic
1103845764 12:123901117-123901139 ATGCTGAGGAGCAAAATTGTGGG - Intronic
1104057830 12:125244266-125244288 ATGCTCAGGAGTGGAATTGCTGG + Intronic
1105451048 13:20500713-20500735 CTGCTGAGGAGAGGCATTGTGGG - Intronic
1105630627 13:22161770-22161792 ATACCTAGGAGTAGAATTGCCGG + Intergenic
1105667097 13:22572236-22572258 GTACTGAGGAGTAGAATTGCTGG - Intergenic
1106038961 13:26071446-26071468 ATGCTTAGAAGTAGGATTGCTGG + Intergenic
1106352459 13:28946359-28946381 CTGCTAAGGAGTGGGATTGAGGG + Intronic
1106837672 13:33652692-33652714 CTACTTAGGAGAAAAAATGTTGG + Intergenic
1106895299 13:34293896-34293918 ATTCCTAGGAGTGGAATTGTTGG - Intergenic
1108381160 13:49855718-49855740 ATACCTAGGAGTAGAATTGTTGG - Intergenic
1108383169 13:49873611-49873633 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1108459192 13:50648117-50648139 GTACCTAGGAGTAGAATTGCTGG + Intronic
1108638230 13:52357379-52357401 CTACTCAGAAGTAGAATTGCTGG - Intergenic
1108683725 13:52801370-52801392 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1108719289 13:53114039-53114061 ATACTTAGGAGTGGAATTGATGG + Intergenic
1109083279 13:57935363-57935385 ATGCTTAAGAGTAGAATTATAGG + Intergenic
1109365302 13:61347994-61348016 CTGTTTAGAAGTAGAATTTCTGG + Intergenic
1110125094 13:71932570-71932592 TTGCTTGAGAGTAGATTTGTTGG + Intergenic
1110590621 13:77253250-77253272 ATACCTAGGAGTAGAATTGCTGG - Intronic
1111989124 13:95099004-95099026 ATGCATAGGAGTGGAATTGCTGG - Intronic
1112180413 13:97073387-97073409 CTGTTTAGTTGTAGAATTGTTGG + Intergenic
1112489693 13:99850655-99850677 ATACCTAGGAGTAGAATTGCTGG - Intronic
1112566253 13:100553265-100553287 CTGCCTGGGAGTGGAATTGCCGG - Intronic
1112968108 13:105224328-105224350 ATGATTAGGAGTGGAATTGATGG + Intergenic
1113132051 13:107048223-107048245 CTACATAGGAATAGAATTTTTGG + Intergenic
1113238377 13:108308856-108308878 CTCCTTAGGAGAAGAATGCTTGG - Intergenic
1113536281 13:111068695-111068717 ATATTTAGGAGTAGAATTGCTGG + Intergenic
1113718773 13:112535300-112535322 ATACCTAGGAGTAGAACTGTTGG + Intronic
1113984561 13:114303483-114303505 CTGGTAAGAAGCAGAATTGTCGG + Intronic
1114364290 14:22010598-22010620 CTGCTTAGGAGAAGAATGGGAGG - Intergenic
1114428439 14:22640104-22640126 CTACCTAGGAGTAGAATTATTGG - Intergenic
1115324365 14:32122052-32122074 ATACTTAAGAGTGGAATTGTTGG + Intronic
1115325793 14:32136618-32136640 ATGCCTAGGAGTGGAATTGCTGG + Intronic
1115625411 14:35187170-35187192 ATACCTAGGAGTAGAATTGGTGG + Intronic
1115671254 14:35614208-35614230 ATACCTAGGAGTAGAATTGCTGG - Intronic
1116803890 14:49472536-49472558 CTACTTAGAAGTAGGATTGCTGG - Intergenic
1116952317 14:50890821-50890843 TACCCTAGGAGTAGAATTGTGGG + Intronic
1117220092 14:53595173-53595195 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1117371418 14:55081739-55081761 ATCCCTAGGAGTAGAATTGCTGG - Intergenic
1117505891 14:56402702-56402724 ATACCTAGGAGTAGAGTTGTGGG + Intergenic
1117922794 14:60743006-60743028 ATATTTAGGAGTAGAATTATTGG + Intronic
1118110916 14:62718690-62718712 CTATATAGGAGTAGAATTGCTGG - Intronic
1118588387 14:67379218-67379240 ATGCCTAGGAGTGGAATTGTTGG + Intronic
1118734109 14:68690019-68690041 CTGCTGAGGAGTGCAGTTGTAGG + Intronic
1118928702 14:70219356-70219378 ATGCCTAGGAGCAGAATTGCTGG + Intergenic
1119581844 14:75791175-75791197 ATGCCCAGGAGTGGAATTGTTGG - Intronic
1119634438 14:76262571-76262593 ATACCTAGGAGTGGAATTGTTGG + Intergenic
1120176627 14:81300808-81300830 AAACATAGGAGTAGAATTGTTGG - Intronic
1120235600 14:81887323-81887345 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
1120375574 14:83702158-83702180 ATACTTAGGAGTCCAATTGTTGG - Intergenic
1120555512 14:85925549-85925571 GTGCCTTGGAGTAGAATTGCTGG + Intergenic
1121624873 14:95376535-95376557 ATGCCTAGGAGTAAAATTGCTGG + Intergenic
1121854821 14:97258215-97258237 ATACCTAGGAGTAGAATGGTTGG - Intergenic
1122166632 14:99830003-99830025 CTACCTAGGAGTAGAATTGCCGG + Intronic
1122430838 14:101641665-101641687 ATTCCTAGGAGCAGAATTGTTGG - Intergenic
1122805836 14:104256395-104256417 ATGACTAGGAGTAGAATTGCTGG + Intergenic
1123909338 15:24951182-24951204 CTGCTTAGGAGTAGAATTGTAGG + Intronic
1123950770 15:25271831-25271853 GTACTTAGGAGCAGAATTGTTGG - Intergenic
1123962548 15:25420786-25420808 GTACTTAGGAGTGGAATTGCTGG - Intronic
1124142649 15:27090398-27090420 GCGTTTAGGAGTGGAATTGTGGG + Intronic
1124406990 15:29402103-29402125 ATTCTTAGAAGTAGAATTCTAGG - Intronic
1124408255 15:29411208-29411230 ATGCTTATGAGTAGAACTGCAGG + Intronic
1124914594 15:33957473-33957495 ATACGTAGGAGTAGGATTGTTGG - Intronic
1125178514 15:36853868-36853890 ATACTTAAGAGTGGAATTGTTGG - Intergenic
1126202910 15:46007991-46008013 GTGCCTAGGAGTAGAATTGCTGG + Intergenic
1126605853 15:50475501-50475523 TTACCTAGGAGTAGAATTGCTGG - Intronic
1126757180 15:51936153-51936175 CTGCTGAGGTGAAGAAGTGTTGG + Intronic
1127085245 15:55418434-55418456 CTCCTTTGGAGTATAATTGCAGG - Exonic
1127092700 15:55482341-55482363 ATACTTAGGAATAGAATTGCTGG - Intronic
1127183426 15:56450764-56450786 ATGCCTAGGAGTGGAATTGCTGG + Intronic
1127916049 15:63456115-63456137 ATGCTTAGGAGGAGAATTGCTGG + Intergenic
1128048988 15:64646012-64646034 ATACCTAGGAGTAGAATTGCTGG - Intronic
1128123621 15:65173526-65173548 ATGTTTAGGAGTGGAATTGCTGG - Intronic
1128259518 15:66222968-66222990 ATGCCTAGGAGTGGAATTGCTGG - Intronic
1129279445 15:74472699-74472721 ATACTTAGGAATAGAATTGCTGG - Intergenic
1129355722 15:74989904-74989926 ATACCTAGGAGTAGAATTGCAGG + Intronic
1129428857 15:75483210-75483232 TTGCTAAGGAGTGGAATTGCTGG - Intronic
1129590298 15:76908858-76908880 ATTCCTAGGAGTAGAATTGCTGG + Intergenic
1129949262 15:79571623-79571645 ATACTGAAGAGTAGAATTGTAGG - Intergenic
1130068173 15:80623417-80623439 ATTCTTAGGAGTGGAATTGCTGG - Intergenic
1131129930 15:89891867-89891889 ATACCTAGGAGTAGAATTGCTGG - Intronic
1133117498 16:3586125-3586147 GTACTTAGGAGTGGAATTGCTGG - Intronic
1133398841 16:5470010-5470032 ATACCTAGGAGTGGAATTGTTGG + Intergenic
1133664223 16:7950069-7950091 ATACTTAGGAATAGAATTGTTGG + Intergenic
1133865727 16:9640795-9640817 ATGCTTAGCAGTAGAATTGCTGG + Intergenic
1134514737 16:14877871-14877893 ATTCCTAGAAGTAGAATTGTTGG - Intronic
1134683479 16:16142655-16142677 CTTCTTGGGAATAGAAGTGTTGG + Exonic
1134702414 16:16276524-16276546 ATTCCTAGAAGTAGAATTGTTGG - Intronic
1134965129 16:18435591-18435613 ATTCCTAGAAGTAGAATTGTTGG + Intronic
1134969416 16:18518126-18518148 ATTCCTAGAAGTAGAATTGTTGG + Intronic
1135198613 16:20417182-20417204 CTACTTAGGAGTACAATTCCTGG - Intronic
1135615976 16:23911468-23911490 CTTCCTAGGAGTGGAATTGCTGG + Intronic
1137289870 16:47044933-47044955 CTGCCTAGGAGTACAATTTTTGG - Intergenic
1137325334 16:47429447-47429469 ATACCTAGGAGTGGAATTGTTGG + Intronic
1137702796 16:50509056-50509078 ATACTTAGGAGTGGAATTGCTGG + Intergenic
1137730930 16:50689424-50689446 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1137740830 16:50771516-50771538 CTCCCTAGGAGTAGAATTGCTGG + Intronic
1138062231 16:53903798-53903820 ATACCTAGGAGTAAAATTGTTGG + Intronic
1138112995 16:54339458-54339480 CTCCCTAGGAGTGGAATTGCTGG + Intergenic
1140027342 16:71302812-71302834 CAGCTTAGGAGCAGGATTGCTGG + Intergenic
1140162185 16:72508440-72508462 ATTCCTAGGAGTGGAATTGTTGG - Intergenic
1140670327 16:77271237-77271259 CTGTTTAGGAGTAGGTTTGCAGG + Intronic
1141114670 16:81298180-81298202 ATGCCTAGGAGTGGAATTGCTGG + Intergenic
1141260296 16:82447301-82447323 ATGTCTAGGAGTAGAATTTTTGG + Intergenic
1142555225 17:770973-770995 ATTCCTAGGAGTAGAATTGCAGG + Intronic
1142633162 17:1239252-1239274 CTGCTTAGGAGCGAAATTGCTGG + Intergenic
1143752691 17:9041685-9041707 CTACCTAGCAGTGGAATTGTTGG + Intronic
1143808319 17:9449124-9449146 CTGCCTAGGAGTAGGATTGCTGG - Intronic
1143930351 17:10416464-10416486 ATACTCAGAAGTAGAATTGTGGG + Intronic
1144202661 17:12955366-12955388 ATCCCTAGGAGTAGAATTGCTGG + Intronic
1144252543 17:13433012-13433034 GTGCCTAGGAGCAGAATGGTTGG + Intergenic
1144644300 17:16961225-16961247 TTGCTTAGGAGTGGAATTACTGG - Intronic
1145158931 17:20561334-20561356 CTACTTAGGAGTGGAATTGCTGG - Intergenic
1146754754 17:35419752-35419774 CTAAGTAGGAGTAGAATTGTTGG - Intronic
1146779480 17:35655653-35655675 ATACCTAGGAGTAGAATTGCTGG + Intronic
1147422445 17:40328924-40328946 ATACCTAGGAGTAGAATTGCTGG + Intronic
1147708224 17:42443246-42443268 ATACCTAGGAGTGGAATTGTTGG + Intergenic
1147772219 17:42875855-42875877 ATGCCTAGGAGTAGAATTTCTGG + Intergenic
1147777943 17:42916734-42916756 ATTCTTAGGAGTGGAATTGCTGG + Intergenic
1148162615 17:45459633-45459655 ATACTTAGGAGTAGACTTGCTGG + Intronic
1148451654 17:47782235-47782257 ATGCTGAGGAGTGGAATTGCTGG - Intergenic
1148801970 17:50233908-50233930 ATACCTAGGATTAGAATTGTTGG + Intergenic
1148823336 17:50373720-50373742 ATACCTAGGAGTAGAATTGCTGG - Intronic
1149718375 17:58817279-58817301 ATGCCTAGGAGTGGAATTGCCGG + Intronic
1149939432 17:60847342-60847364 ATACCTAGGAGTAGAATTGCTGG + Intronic
1150032198 17:61750962-61750984 ATACTTAGGAGTGGAATTGCTGG - Intronic
1150035972 17:61798024-61798046 CTTTTTAGAAGTGGAATTGTTGG - Intronic
1150063256 17:62086909-62086931 GTATCTAGGAGTAGAATTGTTGG - Intergenic
1150393843 17:64806298-64806320 ATACTTAGGAGTAGACTTGCTGG + Intergenic
1151247978 17:72810230-72810252 GTACCTAGGGGTAGAATTGTTGG - Intronic
1152863172 17:82707847-82707869 ATACGTAGGAGTAGAATTGCTGG + Intergenic
1153108279 18:1553126-1553148 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1153254642 18:3158420-3158442 GTTCTTAGAACTAGAATTGTTGG + Intronic
1153327001 18:3830848-3830870 CTGCTTAGAACTAGAATTATAGG - Intronic
1153345657 18:4022925-4022947 TTCCTTAGCAGTAGAATTGGTGG + Intronic
1153721793 18:7911276-7911298 ATACTTAGGAGCAGAATTGCTGG + Intronic
1153873561 18:9344237-9344259 ATACCTAGGAGTAGAATTGCTGG + Intronic
1153887752 18:9482202-9482224 ATACCTAGGAGTAGAATTGCTGG + Intronic
1153916167 18:9747367-9747389 ATACCTAGGAGTAGAATTGCTGG - Intronic
1154275245 18:12953366-12953388 ATGCGTAGGAGTGGAATTGATGG + Intronic
1154275795 18:12958860-12958882 ATACCTAGGAGTAGAATTGCTGG + Intronic
1155045670 18:22101005-22101027 CTGATTAGAAATAGAAGTGTGGG - Intergenic
1155083912 18:22437206-22437228 GTATTTAGGAGTAGAATTGCTGG + Intergenic
1155104681 18:22650712-22650734 ATGCCTAGGAGTGGAATTGCTGG + Intergenic
1155136241 18:22995900-22995922 ATACCTAGGAGTGGAATTGTTGG + Intronic
1155389413 18:25317956-25317978 CTCGTTAGGAATAGAATTGCTGG - Intronic
1155594222 18:27465010-27465032 GTGCCTAGGAGTGGAATTGCCGG - Intergenic
1156207456 18:34901772-34901794 TTTCATAGGAGTAGAATTGCTGG - Intergenic
1156255612 18:35393098-35393120 ATACTTAGGAGTGGAATTGTTGG + Intergenic
1156275465 18:35579961-35579983 ACGCCTAGGAGTGGAATTGTTGG + Intergenic
1156356197 18:36343133-36343155 ATACCTAGGAGTAGAATTGCTGG - Intronic
1156421479 18:36958358-36958380 ATACCTAGGAGTAGAATTGCTGG + Intronic
1157120623 18:44907365-44907387 ATACTTAGGAGCAGAATTTTGGG + Intronic
1157343312 18:46800052-46800074 ATACGTAGGAGTAGAATTGATGG - Intergenic
1157448948 18:47771422-47771444 CTGGTCAGAAATAGAATTGTTGG - Intergenic
1157474571 18:48013081-48013103 ATAGCTAGGAGTAGAATTGTGGG + Intergenic
1157681049 18:49607256-49607278 TTACTTAGGAGTAGAATTGTTGG - Intergenic
1157787448 18:50497249-50497271 ATACTTTGGAGTGGAATTGTTGG + Intergenic
1158934195 18:62349479-62349501 CTGCTAAGGAATAGAATGATGGG - Intronic
1159571180 18:70113525-70113547 ATAATTAGGAGTGGAATTGTTGG - Intronic
1159940285 18:74401656-74401678 CTGCTTAAGAGGAGATTTGGAGG + Intergenic
1160235352 18:77081665-77081687 ATTCTTAGGAGTGGAGTTGTGGG - Intronic
1160310250 18:77782871-77782893 ATGCCTAGAAGTAGAATTGCTGG + Intergenic
1160312101 18:77803919-77803941 GTGCTCAGGAATATAATTGTTGG + Intergenic
1162351546 19:10153143-10153165 CTGCTTAGAAGTAGCGTTGCTGG - Intronic
1163077443 19:14907227-14907249 ATGCCCAGTAGTAGAATTGTTGG - Intergenic
1163330540 19:16634448-16634470 ATTCCTAGGAGTAGAATTGCTGG - Intronic
1164471011 19:28532529-28532551 ATACCTAGAAGTAGAATTGTTGG - Intergenic
1164665042 19:30024297-30024319 ATACCTAGGAGTGGAATTGTTGG + Intergenic
1164820393 19:31245907-31245929 CTGCAGAGAAGTAGGATTGTTGG - Intergenic
1165584393 19:36901004-36901026 CTACCTAGGAGTAGAATTGCTGG - Intronic
1165703390 19:37955902-37955924 CTGCTCAGGAGTGGAATTACTGG + Intronic
925980394 2:9172285-9172307 ATACTTAGGAGGAGAATGGTTGG - Intergenic
926273072 2:11382012-11382034 TTACTTAGGAGTAAAATTGCTGG + Intergenic
926482845 2:13421352-13421374 CTGCCTAGGGATAGAATTGATGG + Intergenic
927335930 2:21924264-21924286 ATACTTAGATGTAGAATTGTGGG + Intergenic
927568548 2:24137292-24137314 TTGGGTAGGAGTGGAATTGTTGG + Intronic
927609174 2:24520228-24520250 TTGCTTAAGAGTAGAATGGCTGG - Intronic
927625213 2:24709249-24709271 CTTCTTAGGAGTAGAACTACAGG + Intronic
928135766 2:28686355-28686377 GTGCTTAGGACTAGAATGGAAGG - Intergenic
928182272 2:29077038-29077060 ATTCTTAGGAGTGGAATTGACGG - Intergenic
928226784 2:29456199-29456221 ATGCCCAGGAGTAGAATTGCTGG - Intronic
928555765 2:32423241-32423263 GTTCTTAAGAGTAGAATTATTGG + Intronic
928555861 2:32424469-32424491 ATACCTAGGAGTGGAATTGTTGG + Intronic
929057413 2:37890411-37890433 ATACGTAGGAGTAGAATTGCTGG - Intergenic
929184353 2:39078425-39078447 GTACTTAGAAGTAGAATTGCTGG - Intronic
929341294 2:40821741-40821763 ATACCTAGGAGTAGAATTGCTGG - Intergenic
929608233 2:43250031-43250053 GTACCTAGGAGTGGAATTGTGGG - Intronic
929815296 2:45225926-45225948 ATGCCAAGGAGTGGAATTGTTGG + Intergenic
929964872 2:46526888-46526910 ATGCCTAGAAGTAGAATTGCTGG + Intronic
930049306 2:47202100-47202122 ATACCCAGGAGTAGAATTGTTGG - Intergenic
930381029 2:50629102-50629124 ATGCTTATGAGTGGAATTGGTGG - Intronic
930551906 2:52846481-52846503 ATACTTAGGAGCAAAATTGTTGG + Intergenic
930675954 2:54200766-54200788 ATTCCTAGGAGTAGAATTGCTGG + Intronic
931440046 2:62283311-62283333 ATACTTAGGAGTGGAATTGCAGG + Intergenic
931861389 2:66358421-66358443 CTGCTTTGGAGTTTGATTGTTGG + Intergenic
931886039 2:66618449-66618471 CTGCCTAGGAGTAGAATTTCTGG - Intergenic
932005763 2:67925427-67925449 ATACTTAGGAGTAGAATTATTGG - Intergenic
932547232 2:72725858-72725880 ATACTTAGGAGTAGAATTTCTGG - Intronic
932725537 2:74176910-74176932 ATACTTAGGAGCAGAATTGCTGG - Intronic
933571177 2:84014672-84014694 ATACCTAGGAGTAGAATTGCTGG - Intergenic
933763400 2:85690901-85690923 CTACCTAGGAGTGGAATTGCTGG + Intronic
933920196 2:87038260-87038282 ATACTTAGGAGTGGAATTGCTGG - Intergenic
933931428 2:87155526-87155548 ATACTTAGGAGTGGAATTGCTGG + Intergenic
934002801 2:87731633-87731655 ATACTTAGGAGTGGAATTGCTGG + Intergenic
934126504 2:88898029-88898051 CTGCTTGGAAGTGAAATTGTTGG - Intergenic
935163952 2:100553433-100553455 ATGCCTAGAAGTGGAATTGTTGG - Intergenic
935495081 2:103770943-103770965 CTGCTTGGGAATGGAAATGTAGG + Intergenic
935554052 2:104487722-104487744 ATACCTAGGAGTAGAATTGCTGG - Intergenic
936242997 2:110804448-110804470 ATACCTAGGAGTAGAATTGCTGG - Intronic
936361692 2:111809913-111809935 ATACTTAGGAGTGGAATTGCTGG - Intronic
937005474 2:118508715-118508737 GTACTTAGGAGTAGAATTGCTGG - Intergenic
937171426 2:119874306-119874328 ATGCCTAGGAGTAGTATTGTTGG - Intronic
937693581 2:124782796-124782818 ATACCTAGGAGTAGAACTGTTGG - Intronic
937865107 2:126744985-126745007 ATGCCTAGGAGTGGAATTTTGGG - Intergenic
938098849 2:128484026-128484048 ATGCCTAGGAGTGGAATTGCTGG - Intergenic
938136082 2:128757855-128757877 ATACCTAGGAGTAGAATTGCTGG + Intergenic
938249515 2:129803445-129803467 ATGCCTAGGAGTAGGATTGCTGG - Intergenic
938413796 2:131087762-131087784 GTACCTAGGAGTGGAATTGTGGG - Intronic
938450025 2:131409882-131409904 ATACCTAGGAGTAGAATTGTTGG - Intergenic
938700246 2:133871500-133871522 ATTCTTAGGAGTGGAATTGCTGG + Intergenic
938907162 2:135848509-135848531 ATACCTAGGAGTGGAATTGTTGG - Intronic
938983461 2:136549076-136549098 ATACCTAGGAGTAGAATTGTTGG + Intergenic
938985754 2:136574045-136574067 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
939205538 2:139097777-139097799 ATGCCAAGGAGTATAATTGTGGG - Intergenic
940228402 2:151424607-151424629 ATGCTTAAGAGTGGAATTGCTGG + Intronic
940544345 2:155064089-155064111 TTGCTTAGTAGTAGGATTGCTGG + Intergenic
941354492 2:164472570-164472592 CTACCTAGGAGTTGAATTGCTGG - Intergenic
941416104 2:165223713-165223735 ATACCTAGGAGTAGAATTGCTGG + Intergenic
941711711 2:168721466-168721488 ATGCTTAGGAATGGAATTGCTGG + Intronic
941727199 2:168874358-168874380 ATACTTAGGAGTGGAATTGCTGG - Intronic
942178923 2:173361299-173361321 ATACATAGGAATAGAATTGTGGG + Intronic
943850170 2:192709966-192709988 CTGCTGAGGAGTAGATGTGTGGG - Intergenic
943888294 2:193251722-193251744 ATACCTAGGAGTGGAATTGTTGG - Intergenic
943904266 2:193477506-193477528 ATACCTAGGAGTAGAATGGTTGG - Intergenic
944164517 2:196704446-196704468 ATTCTTAGGAGTAGAATTACTGG + Intronic
944507812 2:200431107-200431129 ATTCTTAGAAGTAGAATTATTGG + Intronic
944751122 2:202711068-202711090 ATGCCTAGGAGTAGGATTGCTGG + Intronic
944770448 2:202909167-202909189 ATGCTTAGGAGTGGAGTTTTTGG - Intronic
944860487 2:203811490-203811512 GTGCGTAGGAATAGAATTGCTGG + Intergenic
944968830 2:204967894-204967916 CTGCTTAGGTGAAGAATGGGAGG + Intronic
945128065 2:206535437-206535459 ATGCCTAGGAGTAGAACTGCTGG - Intronic
945267776 2:207908201-207908223 ATACCTAGGAGTAAAATTGTTGG + Intronic
945546921 2:211166200-211166222 ATACTTAGGAGTGGAATTGCTGG - Intergenic
945551556 2:211227432-211227454 ATTCTGAGGAGTAGAATTGCTGG + Intergenic
945931761 2:215862288-215862310 ATGCCTAGGAGAGGAATTGTTGG - Intergenic
946283800 2:218686777-218686799 CTACGTAGGAGTAGAATTGCTGG + Intronic
946343587 2:219089217-219089239 GTACCTAGGAGTAGAATTGCTGG - Intronic
947120272 2:226806903-226806925 CTCCTTAGGAGTTCAATTGGTGG - Intergenic
947134090 2:226959762-226959784 ATACCTAGGAGTGGAATTGTTGG + Intronic
947378292 2:229520162-229520184 CTGCTTAGCAGTAGTCTTGCGGG + Intronic
947477101 2:230460128-230460150 CTGCTGAGGAATATAATTGTTGG - Intronic
947814475 2:233026898-233026920 CTGCCTAGGAGTGGAATTGCTGG - Intergenic
948503743 2:238413591-238413613 ATGCTCAGAAGTAGAATTGCTGG + Intergenic
948965661 2:241377865-241377887 ATACCTAGGAGTAGAATTGCTGG + Intronic
1168908323 20:1424705-1424727 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1169501912 20:6168876-6168898 GTGCTTAGAAGTGGAATTGCAGG + Intergenic
1169548988 20:6682232-6682254 ATGCTCAGTAGTAGAATTATTGG - Intergenic
1169625949 20:7569627-7569649 ATACTTAGGAGTACAATTGGTGG - Intergenic
1169798280 20:9489196-9489218 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1169949175 20:11024072-11024094 ATACGTAGGAGTAGAATTGTTGG + Intergenic
1170067120 20:12324542-12324564 ATACTTGGGAGTAGAATTGCTGG - Intergenic
1170577127 20:17672651-17672673 ATACCTAGGAGTAGAATTGCAGG - Intronic
1170673486 20:18456919-18456941 ATACTGAGGAGTGGAATTGTTGG + Intronic
1171145552 20:22778352-22778374 CTGCTGGGGAGAAGAATTGTTGG - Intergenic
1171451348 20:25238135-25238157 TTTCTTTGGAGTAGAATTGCTGG + Intergenic
1171724161 20:28600927-28600949 ATACTTAGGAGTAAAATTGCTGG - Intergenic
1171753892 20:29082114-29082136 ATACTTAGGAGTAAAATTGCTGG + Intergenic
1171788353 20:29495416-29495438 ATACTTAGGAGTAAAATTGCTGG - Intergenic
1171859202 20:30379097-30379119 ATACTTAGGAGTAAAATTGCTGG + Intronic
1172087884 20:32402470-32402492 CTACCTATGAGTAGAATTGCTGG + Intronic
1172373911 20:34420009-34420031 ATGCTTGAGAGTAGAATTGCTGG + Intronic
1172695643 20:36820939-36820961 AGGCTGAGGAGTAGAATTGAAGG + Intronic
1172961277 20:38801927-38801949 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1172966852 20:38841943-38841965 TTACCTAGGAATAGAATTGTTGG + Intronic
1172972028 20:38880825-38880847 ATACCTAGGAGTAGAATTGCTGG + Intronic
1173964782 20:47103951-47103973 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1174211518 20:48882593-48882615 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1174249909 20:49211331-49211353 ATACTTAGGAGTTGAATTGCTGG + Intergenic
1174464344 20:50705628-50705650 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1174675749 20:52352525-52352547 ATGCTGAGGAGTAGAATAGCTGG + Intergenic
1174973048 20:55299489-55299511 ATGTCTAGGAGTAGAATTGGTGG - Intergenic
1175187406 20:57188079-57188101 ACGCCTAGGAGTGGAATTGTTGG - Intronic
1175237022 20:57521548-57521570 ATACTTAGGAGTGGAATTGCTGG - Intronic
1175772928 20:61635150-61635172 CTGCTGAGAAGTTGAATTGCTGG + Intronic
1176058010 20:63158924-63158946 ATGCCTAGGAGCAGAATTGCTGG - Intergenic
1176134202 20:63513392-63513414 GTACTTAGGAGTGGAATTGCTGG - Intergenic
1176518314 21:7803870-7803892 ATACCTAGGAGTGGAATTGTTGG - Intergenic
1177297898 21:19201138-19201160 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1177837104 21:26196811-26196833 ATGCCTAGGAGTGGAATTGCTGG + Intergenic
1177964048 21:27705060-27705082 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1178039733 21:28626867-28626889 ATACTTAGGAGCAGAATTGTTGG - Intergenic
1178091353 21:29166916-29166938 GTTCCTAGCAGTAGAATTGTTGG + Intronic
1178279383 21:31267765-31267787 CTGCTTAGCAGTAGATTAATGGG + Intronic
1178652342 21:34433883-34433905 ATACCTAGGAGTGGAATTGTTGG - Intergenic
1178689001 21:34735455-34735477 CTTCGTAGGAGGATAATTGTGGG - Intergenic
1178880850 21:36449006-36449028 ATTCCTAGGAGTAGAATTGTGGG + Intergenic
1179166006 21:38935656-38935678 CTTCCTAGGAGTGGAATTGCTGG + Intergenic
1179393913 21:41020680-41020702 ATTCTTAGGAGTGGAATTGGGGG - Intergenic
1180297713 22:10959602-10959624 ATACTTAGGAGTAAAATTGCTGG - Intergenic
1180897581 22:19348161-19348183 CTTCTTGGGAGTAGCACTGTAGG - Intronic
1180933762 22:19610776-19610798 CTGCTAAGGAGCAGAAGTGGGGG - Intergenic
1180974329 22:19838797-19838819 ATATCTAGGAGTAGAATTGTTGG - Intronic
1181659790 22:24336759-24336781 ATAATTAGGAGTAGAATTGCTGG - Intronic
1182025810 22:27118135-27118157 ATGCTTAGGAGTGGAATTGCTGG - Intergenic
1182231794 22:28843213-28843235 ATACCTAGGAGTGGAATTGTTGG - Intergenic
1182385964 22:29941417-29941439 ATACCCAGGAGTAGAATTGTTGG + Intronic
1182726451 22:32450059-32450081 ATGCTGAGCAGTGGAATTGTTGG + Intronic
1182819213 22:33200471-33200493 ATGCCTAGGAGTGGAATTGCTGG - Intronic
1183766849 22:39885481-39885503 ATACTTAGGAGTGGAATTGTTGG - Intronic
1184180598 22:42821745-42821767 ATACTTAGGAGTAGATTTGCTGG + Intronic
1184314963 22:43679496-43679518 ATACTTAGGAGTGGAATTGCTGG + Intronic
1184674587 22:46034247-46034269 ATTCTTAGGAGTGGAATTGCTGG + Intergenic
1184954037 22:47870154-47870176 CTTCTGAGGAGTGGAATTGCTGG - Intergenic
949271178 3:2218754-2218776 ATTCTAGGGAGTAGAATTGTAGG - Intronic
949372462 3:3350166-3350188 ATACCTAGGAGTAGAATTGTTGG + Intergenic
949605552 3:5649295-5649317 ATACTTAGGAGTAGAATGGCAGG - Intergenic
950208655 3:11100134-11100156 ATACCTAGGAGCAGAATTGTTGG + Intergenic
950271741 3:11621675-11621697 GTACCTAGGAGTAGAATTGCTGG + Intronic
950375119 3:12565133-12565155 ATACCTAGGCGTAGAATTGTTGG + Intronic
950797970 3:15526124-15526146 ATACTGAAGAGTAGAATTGTTGG - Intergenic
950960807 3:17104807-17104829 ATACTTAGCAGTAGAATTGCTGG - Intergenic
951631286 3:24723930-24723952 ATGCTCAGTAGTAGGATTGTTGG - Intergenic
952915396 3:38234719-38234741 GTGCCTAGGAGTAGAACTGCTGG - Intronic
953062320 3:39437451-39437473 ATACTTAGGAGTGGAATTGCTGG + Intergenic
953139812 3:40218117-40218139 ATACTTAGGAGTAGAATTGTTGG - Intronic
953384454 3:42498718-42498740 CTGCTTGGGTGTGGGATTGTGGG - Intronic
953532105 3:43748188-43748210 CTGCTTTGGAGTTGAGATGTGGG + Intergenic
953655809 3:44853561-44853583 ATGCCTAGGAGTAGAATTACTGG + Intronic
953751698 3:45613844-45613866 ATACCTAGGAGTAGAATTGCTGG + Intronic
953935787 3:47040981-47041003 GTACTTAGAAGTGGAATTGTTGG - Intronic
954530695 3:51316476-51316498 ATACTTAGGAATAGGATTGTTGG + Intronic
955452194 3:59081131-59081153 ATACCTAGGAGTAGAATTGCTGG + Intergenic
957647801 3:82955742-82955764 ATACCTAGGAGTAGAATTGCTGG + Intergenic
960083112 3:113562347-113562369 ATGCCTATGAGTAGAATTGCTGG - Intronic
960348953 3:116570619-116570641 ATACTTAGGAGTTGAATTATTGG + Intronic
960880881 3:122343661-122343683 ATACCTAGGAGTAGAATTGCTGG + Intergenic
960921756 3:122754112-122754134 ATACCTAGGAGTAGAATTGCTGG - Intronic
961966258 3:130906524-130906546 ATACTTAGGAGTAGAAGTGCTGG + Intronic
963198151 3:142557021-142557043 CTACCTAGGAGTAGTATTGTTGG - Intronic
963809394 3:149760124-149760146 GTATCTAGGAGTAGAATTGTTGG - Intergenic
963915270 3:150853937-150853959 CAGCCTAGGAGTGGAATTGCTGG + Intergenic
964206301 3:154178736-154178758 ATACTTAGGAGTGGAATTGAAGG + Intronic
964285160 3:155109724-155109746 TTGATCAGGAGTAGAATTCTGGG + Intronic
964559190 3:157974764-157974786 ATTCTGAGGAGTGGAATTGTTGG - Intergenic
965594608 3:170398580-170398602 ATACCTAGGAGTAGAATTGTTGG + Intergenic
965696900 3:171418335-171418357 TTTCTCAGGAGTAGAATTGCTGG - Intronic
965989200 3:174795550-174795572 ATATTTAGGAGTAGAATTGTTGG + Intronic
966053348 3:175649985-175650007 ATTCCTAGGAGTGGAATTGTTGG - Intronic
966450513 3:180054515-180054537 ATAATTAGGAGTAGAATTGCTGG - Intergenic
966467659 3:180249604-180249626 ATGCCTAGGAGTAGATTTTTAGG - Intergenic
966500976 3:180638933-180638955 ATACTTAGGAGTAAAATTGCTGG - Intronic
967142968 3:186578398-186578420 ATGCTTGAGAGTAGAATTGCTGG + Intronic
967355901 3:188570862-188570884 TTGCTTAGGAGGAGAATATTAGG - Intronic
967489412 3:190072518-190072540 ATCCTTAGAAGTAGAATTGCTGG - Intronic
967999460 3:195194543-195194565 ATTCCTAGGAGTAGAATTGCTGG - Intronic
968395172 4:229211-229233 CTACTTAGGAGTGGGATTGCTGG + Intergenic
968414083 4:413905-413927 CTACTTAGGAGTGGGATTGCTGG + Intergenic
969340904 4:6540585-6540607 ATGCCTAGGAGTAGAATTGCTGG + Intronic
970386025 4:15557749-15557771 CTGCATACAATTAGAATTGTAGG + Intronic
971185808 4:24374872-24374894 ATACTTAGGAGTGGAATTGTTGG - Intergenic
972025251 4:34367964-34367986 ATACCAAGGAGTAGAATTGTTGG - Intergenic
972844639 4:42972844-42972866 CTGCTAAAGAGTAGAACTGAAGG - Intronic
973573501 4:52263615-52263637 CTTCTTAGGAGTAAAAGTCTTGG + Intergenic
974446470 4:61990020-61990042 ATGCTTAGGAGTAGAATTGCTGG - Intronic
975530951 4:75398887-75398909 ATGCTTAGGAGAGGAATTGGTGG - Intergenic
975768460 4:77694686-77694708 ATGCCTAGAAGTGGAATTGTTGG - Intergenic
976443051 4:85098743-85098765 ATGCTCAGAAGTATAATTGTTGG + Intergenic
976800427 4:88984917-88984939 ATAACTAGGAGTAGAATTGTTGG - Intronic
976806041 4:89048113-89048135 GTACCTAGGAGTAGAATTATCGG - Intronic
977366287 4:96072450-96072472 ATGCTTGGTAGTAGAATTGCTGG - Intergenic
978050766 4:104197003-104197025 ATGCCTAGGAGTGGAATTGCTGG + Intergenic
978553240 4:109950374-109950396 ATCATAAGGAGTAGAATTGTTGG - Intronic
978882812 4:113728141-113728163 ATACTTAGGAGTAGAATTGATGG - Intronic
979187791 4:117820040-117820062 ATATTTAGGAGTAGAATTGCTGG - Intergenic
979352325 4:119658804-119658826 ATATTTAGGAGTAGAATTGCTGG + Intergenic
979991070 4:127376205-127376227 TTACCTAGGAGTAGAATTGCTGG - Intergenic
980282725 4:130741394-130741416 ATACTTAGAAGTAGAATTGCTGG + Intergenic
980345445 4:131610873-131610895 TTGCTTAGAAGTAGAAATATGGG - Intergenic
980724749 4:136743517-136743539 CTGCTGAGGAGGGGCATTGTCGG + Intergenic
981147204 4:141339236-141339258 ATGCTTAGGAGAAGTGTTGTGGG - Intergenic
981187660 4:141823080-141823102 ATGCTTAGGTGTAGATTTTTGGG - Intergenic
981202670 4:141999458-141999480 CTGCCTAGGAGTAGAATTGCTGG + Intergenic
984631791 4:182068448-182068470 TTGCTTAGTAGTAGCAATGTAGG - Intergenic
984747202 4:183233082-183233104 ATGCCTTGAAGTAGAATTGTTGG + Intronic
985116001 4:186591717-186591739 CTTCTTAGGAAAAGAAGTGTAGG + Intronic
985437336 4:189942717-189942739 ATACTTAGGAGTAAAATTGCTGG + Intronic
985698278 5:1355356-1355378 CTGCTTAGAAGTGGAATTGAAGG + Intergenic
985702028 5:1379227-1379249 CTGCTCAGGAGTTGAAGTGCAGG + Intergenic
986299770 5:6468690-6468712 CTCCTAAGAAGTAGAATTGAAGG - Intronic
986652865 5:9981767-9981789 ATACTTAGAAGTGGAATTGTGGG - Intergenic
986666142 5:10106246-10106268 ATACTTAGGAGTGGAATTGACGG - Intergenic
987800206 5:22685904-22685926 ATGCTTAGGAGTAGAATTGCTGG + Intronic
988384688 5:30546719-30546741 ATATTTAGGAGTAGGATTGTTGG - Intergenic
988462015 5:31447983-31448005 ATACTTAGGAGTAGAATTGCTGG - Intronic
988767362 5:34394252-34394274 TTGTCTAGGAGTGGAATTGTGGG - Intergenic
988988273 5:36643169-36643191 TTACTTAGGAATAGAATTGCTGG + Intronic
988999198 5:36743547-36743569 CTTCTTAAGAGTAAAATTCTTGG - Intergenic
989131225 5:38108668-38108690 ATGATTAGAAGTAGAATTGCTGG + Intergenic
989325145 5:40183998-40184020 ATACTTAGGAGTGGAATTATTGG - Intergenic
989702279 5:44283905-44283927 ACATTTAGGAGTAGAATTGTTGG - Intergenic
991142694 5:63263096-63263118 TTGCTTAGAAGTAGAAATATGGG + Intergenic
991310850 5:65239982-65240004 ATACTTAGGAGTAGAATTGCTGG - Intronic
991983981 5:72263876-72263898 CTACCTAGGAATAGAATTTTTGG - Intronic
992130892 5:73691920-73691942 ATTCCTAGGAGTAGAATTGCTGG + Intronic
992519056 5:77530251-77530273 ACACTTAGTAGTAGAATTGTTGG - Intronic
992628913 5:78661881-78661903 ATGCCTATAAGTAGAATTGTTGG - Intronic
992703948 5:79369037-79369059 TTACCTAGGAGTAGAATTGCTGG - Intergenic
993414136 5:87604978-87605000 CTGCTTTGGGGTAGATTAGTTGG + Intergenic
993608876 5:90030562-90030584 ATACCTAGGAGTAGAATTGTTGG - Intergenic
993708893 5:91203160-91203182 CTGCCTAGGAGTGAAATTGCTGG - Intergenic
993890899 5:93471320-93471342 ATTCTTAGGAGTAGAATTACTGG - Intergenic
993925431 5:93859920-93859942 ATACTTATTAGTAGAATTGTTGG - Intronic
994029264 5:95122627-95122649 ATACCTAGGAGTGGAATTGTTGG - Intronic
995440059 5:112181490-112181512 ATACCTAGGAGTAGAATTGCTGG - Intronic
995680191 5:114708534-114708556 CTACCTAGGAGTAGAATGGCTGG - Intergenic
996161833 5:120175774-120175796 CTTCTTAGGATAAGAATAGTTGG - Intergenic
996730524 5:126713307-126713329 ATGCTTGGGAGTAGAGTTGCTGG - Intergenic
996788009 5:127261617-127261639 ATACTTAGGAGTGGAATTGCTGG + Intergenic
996864350 5:128103101-128103123 ATGCTGAGGAGTAGAATTGCTGG + Intronic
997397406 5:133574577-133574599 TTACTTAGGAGTTAAATTGTTGG - Intronic
997405331 5:133641530-133641552 ATTCTTTGGAGTAGAAGTGTTGG - Intergenic
997881235 5:137592368-137592390 ATACCTAGGAGTAGAATTGCTGG - Intronic
998062556 5:139130608-139130630 ATGCCTAGGAGTGGAATTGCCGG - Intronic
998257998 5:140603852-140603874 ATACTAAGGAGTAGAATTGATGG + Intergenic
998815421 5:146009140-146009162 TTACTTAGGAGTGGAATTGATGG + Intronic
998893879 5:146777104-146777126 ATGCCTAGGAGTGGAATTGCTGG - Intronic
999018761 5:148139636-148139658 ATGCTTAGTAGTGGAATTGCTGG - Intergenic
999558911 5:152777435-152777457 ATGTCTAGGAGTAGAATTGTGGG + Intergenic
999846739 5:155489987-155490009 CTATTTAGAAGTAGAATGGTTGG + Intergenic
1000015817 5:157274583-157274605 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1001192564 5:169644197-169644219 AGGATTTGGAGTAGAATTGTAGG + Intronic
1001370447 5:171194718-171194740 ATACCTAGGAGTAAAATTGTTGG + Intronic
1001833598 5:174810915-174810937 ATGCTTAGGAGTGGAAGTGCTGG - Intergenic
1002378983 5:178811487-178811509 CTGCTGAGGAATAGAACTGCAGG - Intergenic
1002395992 5:178955073-178955095 TTGCCTAGGAGTAGGATTGCTGG + Intronic
1003151684 6:3557606-3557628 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1003397740 6:5767471-5767493 ATTCCTAGGAGTAGAATTGCTGG + Intronic
1003594918 6:7465899-7465921 TTACCTAGGAGTGGAATTGTTGG - Intergenic
1004093665 6:12531073-12531095 ATACTTAGGAGTATGATTGTTGG - Intergenic
1004133391 6:12942996-12943018 CTGTCTAGGAGTGGAATTGCTGG - Intronic
1004228240 6:13807639-13807661 ATACTTAGGAGTAGAATTGCTGG + Intronic
1004795802 6:19082831-19082853 GTGCCTAGGATTGGAATTGTTGG - Intergenic
1005316764 6:24610556-24610578 ATACATAGGAGTAGAATTGCTGG - Intronic
1006178454 6:32138453-32138475 CTGCTTGGGTTTAAAATTGTGGG - Intergenic
1006504867 6:34482631-34482653 ATACCTAGGAGTAGAATTGCTGG + Intronic
1007233857 6:40376453-40376475 GTACCTAGGAGTAGAATTGCGGG - Intergenic
1007379330 6:41477225-41477247 ATCCTTAGGAGTAGAATTGCTGG + Intergenic
1007466488 6:42055436-42055458 ATACCTAGGAGTGGAATTGTTGG + Intronic
1008108972 6:47471983-47472005 ACGCTTAGCAGTAGAATTGCTGG - Intergenic
1008690094 6:53969000-53969022 CTGCAGAGGAGTAGAAATTTGGG - Intronic
1008881672 6:56386449-56386471 ATACCTAGGAGTGGAATTGTTGG + Intronic
1008972476 6:57386019-57386041 GTGTTTAGGAATGGAATTGTAGG + Intronic
1009609257 6:65918433-65918455 ATACTTAGGAATAGAATTGTTGG + Intergenic
1009874410 6:69487253-69487275 TTACCTAAGAGTAGAATTGTTGG - Intergenic
1009937489 6:70250961-70250983 CTACCTAGGAGTGGAATTGCTGG - Intronic
1010617718 6:78032783-78032805 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
1010794355 6:80102157-80102179 ATACTTAGGAGTGGAATTGCTGG + Intergenic
1010836352 6:80591546-80591568 ATACTTAGGAGTGGAATTGCTGG + Intergenic
1010988198 6:82450220-82450242 AGGGCTAGGAGTAGAATTGTAGG + Intergenic
1011776143 6:90732847-90732869 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1012200197 6:96396557-96396579 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1012621169 6:101345692-101345714 ATGCATAGAAGCAGAATTGTTGG - Intergenic
1013020846 6:106216228-106216250 ATACTTAGGAGTAGAATTGCTGG - Intronic
1013460842 6:110373487-110373509 TTGTTTTGGAGAAGAATTGTGGG - Intergenic
1013563927 6:111336655-111336677 GTACCTAGGAGTAGAATTTTTGG - Intronic
1013571984 6:111437217-111437239 ATACCTAGGAGTAGAATTGCTGG - Intronic
1013573318 6:111452332-111452354 ATACTTAGGAGTGGGATTGTTGG - Intronic
1013631990 6:111994791-111994813 ATGCCTAGGAGTGGAATTGCTGG - Intergenic
1014088749 6:117378153-117378175 ATACCTAGGAGTAGAATTGCTGG - Intronic
1014229618 6:118888553-118888575 ATGCTTAGGAGTGGAATTGCTGG - Intronic
1014233152 6:118926789-118926811 CAGCTAAGGAGTAGAACTGCTGG + Intronic
1014511468 6:122327718-122327740 GTACTGAGGAGTAGAATTGGTGG - Intergenic
1015607421 6:134973073-134973095 ATGCCTAGGAGTGGAATTGCTGG - Intronic
1016230243 6:141795134-141795156 ATACCTAGGAGTAGAATTGCAGG - Intergenic
1016602372 6:145877068-145877090 ATACCTAGGAGTAGAAATGTTGG + Intronic
1016717225 6:147248640-147248662 CTGTTTAGGAATAAAATTGCTGG - Intronic
1016897923 6:149072179-149072201 ATGCCTAGGAGCAGAATTGCTGG - Intronic
1017132083 6:151116255-151116277 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1017678781 6:156842621-156842643 ATACCTAGGAGTAGAATTGCTGG + Intronic
1017855453 6:158347373-158347395 AGGCTTAGCAGTAGAATGGTAGG - Intronic
1018306295 6:162459995-162460017 TAGCCTAGGAGTAGAATTGCAGG - Intronic
1019695455 7:2443517-2443539 ATGCCTAGGAGTAGGAGTGTGGG + Intergenic
1020498716 7:8889879-8889901 ATGCCTAGGAGTACAATTGTTGG + Intergenic
1021462242 7:20901454-20901476 CTTTCTAGGAGTAGAATTGCCGG - Intergenic
1021470471 7:20996651-20996673 ATGCCTAGGAGTGGAATTGCTGG + Intergenic
1022203415 7:28139625-28139647 CTTCTGGGGACTAGAATTGTTGG - Intronic
1022268013 7:28777057-28777079 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1023071261 7:36436483-36436505 ATACATAGGAGCAGAATTGTGGG + Intronic
1023530341 7:41146921-41146943 ATGCCTAGGAGTAGAGTTGGTGG - Intergenic
1023604206 7:41913265-41913287 ATACTTAGGAGTGGAATTGTTGG - Intergenic
1023663982 7:42500757-42500779 ATACCTAGGAGTGGAATTGTTGG + Intergenic
1024336554 7:48212446-48212468 ATACCTAGGAGTAGAATTCTTGG + Intronic
1024377625 7:48657161-48657183 CTGCTTAGGAGTAGGTTGGCAGG + Intergenic
1024443145 7:49444984-49445006 ATACTTAGGAGTAGAATTATTGG + Intergenic
1024838189 7:53549468-53549490 GTGCTTAGGAGTAGGATTTCTGG + Intergenic
1024909848 7:54434753-54434775 CTGCTTATGAGTAGTATTATTGG - Intergenic
1026247211 7:68631745-68631767 ATGCTTAGGAGTGGGATTGCTGG + Intergenic
1026547163 7:71333495-71333517 TTTCTTAGGAGTGGAATTGCTGG + Intronic
1028396902 7:90379677-90379699 ATACTTAGGAGTGGAATTGCTGG + Intronic
1028555678 7:92121450-92121472 ATACCTAGGAGTAGAATTGCTGG - Intronic
1028861187 7:95652482-95652504 ATACTTAGAAGTAGAATTGTGGG + Intergenic
1029013327 7:97286290-97286312 ATACCTAGAAGTAGAATTGTTGG + Intergenic
1029027905 7:97437237-97437259 ATGCCTAAGAGTAGAATTGCTGG - Intergenic
1030014797 7:105208272-105208294 ATACTTGGGAGTGGAATTGTTGG - Intronic
1030021872 7:105283265-105283287 ATACCTAGGAGGAGAATTGTTGG - Intronic
1030156918 7:106464957-106464979 CTGCCCAGGGGTAGAATTGTGGG - Intergenic
1030511088 7:110482681-110482703 GTACTTAGAAGTAGAATTGCTGG - Intergenic
1030830943 7:114220635-114220657 CTGCTTAGGAGAAGAGTGGAAGG + Intronic
1031107213 7:117559383-117559405 CTGCTTAGGATGATAATTGGAGG + Intronic
1031882594 7:127213885-127213907 ATTCCTAGGAGTAGAATTGCTGG - Intronic
1031915308 7:127557424-127557446 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1032519267 7:132530722-132530744 ATACTTAGGAGTGGAATTGCTGG - Intronic
1032548700 7:132764574-132764596 ATACTTAGGAGTAGAATTCCTGG - Intergenic
1032624813 7:133580354-133580376 CTACTCAGAAGTGGAATTGTTGG + Intronic
1032734171 7:134674773-134674795 ATGCTTAGTAGTGGAATTGCTGG + Intronic
1033222143 7:139535011-139535033 ATGCTTAGGAGTGGAGTTGCTGG - Intronic
1033225150 7:139555523-139555545 ATGCCTAGAAGTAGAATTGCTGG + Intergenic
1033335185 7:140446288-140446310 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1033382956 7:140841371-140841393 ATGCCTAGGAATAGAATTGCTGG - Intronic
1033581180 7:142737364-142737386 ATACTTAGGAGTATAATTGCTGG - Intergenic
1034230614 7:149524432-149524454 ATGCCTAGTAGTAGAATTGCTGG - Intergenic
1035430051 7:158812574-158812596 ATACCTAGGAATAGAATTGTTGG - Intronic
1035484678 7:159213565-159213587 CTGCTCAGCACTACAATTGTGGG - Intergenic
1035563245 8:624394-624416 GTGCCTAGGAGTAGAACTGCAGG - Intronic
1036120832 8:6015600-6015622 ATGCCTAGGAGTAGAATGCTGGG - Intergenic
1036554777 8:9848790-9848812 CTACCTAGGAGTGGAGTTGTTGG - Intergenic
1036989121 8:13571718-13571740 ATACTTAGAAGTAGAATTGCTGG + Intergenic
1037025393 8:14029309-14029331 ATACTTAGGAGTGGAATTGATGG - Intergenic
1037140609 8:15515183-15515205 CTACTTGGGAGTTGAATTTTAGG + Intronic
1037293531 8:17376447-17376469 ATACTTAGGAGCAGAATTGCTGG + Intronic
1037332480 8:17757019-17757041 ATTCTTAGGAGTAGAATTGCTGG - Intronic
1037400377 8:18489871-18489893 ATGCCTTGGAGTAGAATTGTTGG - Intergenic
1037408891 8:18573135-18573157 TTACTTAGGAGTAGAATTGCTGG - Intronic
1037533022 8:19796816-19796838 ATACTTAGGAATAGAATTGCTGG - Intergenic
1037541815 8:19879457-19879479 CTGCTTAGCAGAAGAATTAGAGG - Intergenic
1038032671 8:23657166-23657188 TTGCCTAGGAGTGGAATTGCCGG + Intergenic
1038226544 8:25663386-25663408 GTGGTTAGGGGTAGAAGTGTGGG - Intergenic
1038274249 8:26107174-26107196 ATACTTAAGAGTAGAATTGCTGG - Intergenic
1038320568 8:26522361-26522383 CTGCCTAGAAGTAGAATTGCTGG + Intronic
1038344998 8:26724580-26724602 CTGTATAGAAGTGGAATTGTTGG + Intergenic
1038582082 8:28756603-28756625 ATACCTAGGAGTGGAATTGTTGG + Intergenic
1039452411 8:37686045-37686067 ATTCCTAGGAGTAGAATTGTTGG - Intergenic
1039768387 8:40656423-40656445 ATGCCTAGGAGTAGAATTGCTGG - Intronic
1040001502 8:42580539-42580561 CTGCTTAGGAAATGAATTGAGGG + Intergenic
1040506797 8:48056363-48056385 ATATTTAGGAGTGGAATTGTTGG + Intronic
1040885385 8:52257293-52257315 CTACTTAGAAGAAGAATTGCTGG + Intronic
1040938577 8:52808455-52808477 ATACCTAGGAGTACAATTGTTGG + Intergenic
1041020629 8:53634711-53634733 CTGCCCAGGAGTACAATTGCTGG + Intergenic
1041041168 8:53847492-53847514 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1041059955 8:54025690-54025712 GAACCTAGGAGTAGAATTGTTGG + Intergenic
1041442669 8:57914383-57914405 CTGCTTAGGCCTAGAAATCTTGG + Intergenic
1041647389 8:60267326-60267348 AAGCTTGGGAGTAGATTTGTAGG - Intronic
1041820455 8:62026647-62026669 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1042288602 8:67142677-67142699 GTGCCTAGGAATAGAATTGCTGG + Intronic
1043583598 8:81740617-81740639 ATGATAAGGAGTAGAAATGTGGG - Intronic
1044345233 8:91097183-91097205 ATACTTAGGGGTGGAATTGTTGG - Intergenic
1044647854 8:94463552-94463574 ATTCCTAGGAGTAGAATTGCTGG - Intronic
1044855868 8:96475236-96475258 ATGCCTAGGAGTAGAATTGCTGG - Intergenic
1044883557 8:96749840-96749862 ATTCTTAGAAGTAGAATTGGTGG - Intronic
1045004481 8:97906047-97906069 ATACTAAGGAGTAGAATTGCTGG + Intronic
1045156505 8:99479910-99479932 CTACTTAGGAGTGGAATAGCTGG + Intronic
1045223678 8:100223281-100223303 ATGCCTAGGAGTAGAATTGCTGG + Intronic
1045339728 8:101242734-101242756 TTGCCTAGGAGTAGAATTACTGG + Intergenic
1045372474 8:101538497-101538519 CTGCTTTGGAGGAAAATTTTGGG - Intronic
1045556111 8:103216271-103216293 ATACCTAGGAGTGGAATTGTTGG + Intronic
1045672426 8:104571196-104571218 ATACTTAGGAGAAGAATTGCTGG - Intronic
1046242839 8:111520577-111520599 ATGCATAGGAGGAGAATTGTAGG + Intergenic
1047107328 8:121747089-121747111 ATACTTAAGAGTAGAAATGTTGG + Intergenic
1047323730 8:123816354-123816376 CTTCTTAGGATTAGAACTGCTGG - Intergenic
1047878178 8:129163716-129163738 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1047950399 8:129928921-129928943 ATGCCTAGGAATAGAATTATTGG - Intronic
1048325988 8:133439529-133439551 ATGCCTAGGAGTAGAATTGCTGG + Intergenic
1048474517 8:134731222-134731244 ATTCCTAGGAGTGGAATTGTTGG - Intergenic
1048490558 8:134888417-134888439 ATACTTAGGAGTGGAATTGCTGG + Intergenic
1049101732 8:140584466-140584488 ATACCTAGGAGTAGAATTGCTGG - Intronic
1050141779 9:2523598-2523620 CTGCTTAGAACCAGAATTTTTGG - Intergenic
1050281280 9:4052835-4052857 ATACCTAGGAGTAGAATTGCTGG + Intronic
1051417928 9:16862147-16862169 ATGCTCAAGAGTAGAATTGTTGG - Intronic
1051696439 9:19772821-19772843 ATGCTTATGAGTAGAATTGCTGG - Intronic
1051715693 9:19980930-19980952 GTGATTAGGAGTAGTATTTTGGG - Intergenic
1052539938 9:29797292-29797314 ATGCTTAGGAGTATAATTGTTGG - Intergenic
1052681245 9:31695904-31695926 ATGCTCAGTAGTAGAATTGATGG - Intergenic
1052778662 9:32758153-32758175 ATTCTTAGGTGTAGAATTGCTGG - Intergenic
1052845871 9:33336046-33336068 ATACCTAGGAGTAGAATTGCTGG + Intronic
1052899816 9:33782847-33782869 ATACTTAGGAGTATAATTGCTGG - Intronic
1052912197 9:33893577-33893599 ATACCTAGGAGTGGAATTGTGGG + Intronic
1053026914 9:34737549-34737571 ATACATAGGAGTAGAATTGCTGG + Intergenic
1053386504 9:37695167-37695189 ATACTTAGGAGTGGAATAGTTGG + Intronic
1053725438 9:40994145-40994167 ATACTTAGGAGTAAAATTGCTGG + Intergenic
1055385016 9:75752015-75752037 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1055567894 9:77587279-77587301 ATGCTTAGAAGTGGAATTGCTGG - Intronic
1055579566 9:77693279-77693301 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1056145715 9:83727015-83727037 ATACTTAGAAGTAGAATTGCTGG - Intergenic
1057350249 9:94290777-94290799 ATTCCTAGGAGTGGAATTGTTGG + Intronic
1057438969 9:95068194-95068216 ATTCCTAGGAGTAGAATTGCTGG + Intronic
1057542178 9:95986079-95986101 CTGCTTTGGAGGAGAGTTGGGGG - Intronic
1057771899 9:97975583-97975605 TTGCCTAGGAGTAGAATTGCTGG + Intergenic
1057885957 9:98829984-98830006 GTACGTAGGAGTAGAATTGCAGG + Intronic
1058569874 9:106329391-106329413 ATACCTAGGAGTGGAATTGTTGG - Intergenic
1058880503 9:109281878-109281900 TTACCTAGAAGTAGAATTGTTGG - Intronic
1058964665 9:110025549-110025571 GTACCTAGGAGTAGAATTGCTGG + Intronic
1059056641 9:110988764-110988786 ATACTTAGGAGTGGAATTGCTGG - Intronic
1059205967 9:112465898-112465920 CTACATGGGAGTAGAATTCTAGG + Intronic
1059217333 9:112576854-112576876 CTACCTAGGAGTGGAATTGCTGG + Intronic
1059347722 9:113641615-113641637 ATGCTTAGGAGTGGAATTGCTGG + Intergenic
1060059917 9:120449996-120450018 ATACCTAGGAGTAGAATTGATGG - Intronic
1060467904 9:123923912-123923934 ATACTTAGGAGTGGAATTGCTGG - Intronic
1060775683 9:126372384-126372406 ATACCTAGGAGTAGAATTGCTGG + Intronic
1061220891 9:129251131-129251153 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1203449371 Un_GL000219v1:97828-97850 ATACTTAGGAGTAAAATTGCTGG - Intergenic
1186023905 X:5287488-5287510 ATACCTATGAGTAGAATTGTTGG - Intergenic
1186315573 X:8365875-8365897 CTACGTAGGAGTTGAATTGCTGG + Intergenic
1186399930 X:9248333-9248355 ATACCTAGGAGTGGAATTGTTGG - Intergenic
1186801282 X:13094609-13094631 GTACTTAGGAGTAAAATTGCTGG + Intergenic
1186986744 X:15024647-15024669 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1187124547 X:16442333-16442355 ATACTTAGGAGTGGAATTGTTGG - Intergenic
1187351631 X:18523851-18523873 ATACCTAGGAGTAGCATTGTTGG + Intronic
1187365666 X:18664038-18664060 CTACTTAGGAGTGGAATTGCTGG - Intronic
1187495443 X:19791288-19791310 ATGCTTAGCAGTGGAGTTGTTGG - Intronic
1187680718 X:21765051-21765073 ATGCCTGGGAGTAGAATTGCTGG + Intergenic
1188794989 X:34452578-34452600 TTGCTTAGGAGCAAAATTGCTGG - Intergenic
1188801335 X:34534305-34534327 ATGTTTAGGCGTAGAATTGCAGG + Intergenic
1189073783 X:37894306-37894328 ATACTCAGGAGTAGAATTGTTGG + Intronic
1189432301 X:40958483-40958505 ATGCCTAGGAGTGGAATTGCTGG - Intergenic
1189434322 X:40977913-40977935 CCATCTAGGAGTAGAATTGTTGG + Intergenic
1189887023 X:45557668-45557690 ATACCTAGGAGCAGAATTGTGGG + Intergenic
1189914773 X:45845991-45846013 ATGCTCAGGAGAGGAATTGTAGG - Intergenic
1190038321 X:47047751-47047773 ATACTTAGGAGTAGAATTACTGG - Intronic
1190155103 X:47984395-47984417 GTACCTAGGAGTAGAATTGCTGG - Intronic
1190316108 X:49152276-49152298 ATACCTAGGGGTAGAATTGTTGG - Intergenic
1190428783 X:50357799-50357821 ATACTTGGGAGTAGAATTGCTGG + Intergenic
1191218689 X:57961722-57961744 ATACTTAGGAGTAAAATTGTTGG + Intergenic
1191782879 X:64887142-64887164 AAGCCTAGGAGTAGCATTGTAGG - Intergenic
1191892538 X:65959480-65959502 ATTCTTAGAAGTAAAATTGTTGG + Intergenic
1192289710 X:69781256-69781278 CTACCTAGGAGTAGAATTACTGG + Intronic
1192413639 X:70957632-70957654 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1192595321 X:72401088-72401110 ATACTTAGGAGTGGAATTGCTGG + Intronic
1192601697 X:72471349-72471371 ATACCTAGGAGTAGAATTGCTGG + Intronic
1192866714 X:75141695-75141717 TTTCTTAGAAGTAGAATTGTTGG + Intronic
1193275205 X:79578288-79578310 ATTCTTAGGAGTGGAATTATTGG + Intergenic
1193564166 X:83056899-83056921 GTGTATAGGAGTAGAATTGCTGG - Intergenic
1193605021 X:83556424-83556446 ATACTTAGGAGTGGAATTGCTGG + Intergenic
1193987349 X:88260317-88260339 ATGCCCAGTAGTAGAATTGTGGG + Intergenic
1194176472 X:90655336-90655358 CTGCTGAGGAGGGGCATTGTGGG - Intergenic
1194415137 X:93602529-93602551 ATACTTAGGAGTAGGATTGCAGG - Intergenic
1194629006 X:96260469-96260491 ATACCTAGGAGTAGAATTATAGG + Intergenic
1194750193 X:97675575-97675597 CTACCCAAGAGTAGAATTGTTGG + Intergenic
1194776666 X:97973513-97973535 ATGCTCAGGAGTACAATTGCTGG + Intergenic
1194789518 X:98129244-98129266 ATACTTAGGAGTAGAATTACTGG - Intergenic
1195490073 X:105457829-105457851 ATGCTTAGGAGTGGAATTACTGG + Intronic
1195492862 X:105493276-105493298 ATACCTAGGAGTAGAATTGCTGG + Intronic
1195501091 X:105600763-105600785 CTACTAAGAAGTAGAATTGCTGG + Intronic
1195560266 X:106275129-106275151 CTGCATGAGAGTAGCATTGTAGG - Intergenic
1195561696 X:106291210-106291232 CTGCATGAGAGTAGCATTGTAGG + Intergenic
1195895467 X:109741875-109741897 ATACTTAGGAGTAGAATTGTTGG - Intergenic
1195901549 X:109802998-109803020 CTGCCCAGGAGTAAAATTGCTGG - Intergenic
1196008391 X:110859607-110859629 ATGCTTAGGAGTAGAAGTGCTGG - Intergenic
1196336414 X:114541568-114541590 ATACCTAGGAGTGGAATTGTTGG - Intergenic
1196440798 X:115718282-115718304 ATACTTAGGAGTGGAATTGCTGG + Intergenic
1196693385 X:118584559-118584581 ATGCCTAGGAGTGGAATTGCAGG + Intronic
1196750507 X:119112823-119112845 ATACCTAGGAGTGGAATTGTTGG - Intronic
1196967196 X:121069307-121069329 ATACCTAGGAGTAAAATTGTTGG + Intergenic
1196977046 X:121170307-121170329 ATACCTAGGAGTGGAATTGTAGG + Intergenic
1196977263 X:121173613-121173635 ATACTTAGGAGTAGAATTGCTGG + Intergenic
1197621488 X:128755383-128755405 ATACCTAGGAGTAGAATTGCTGG + Intergenic
1197902272 X:131387027-131387049 ATGCCTAGGAGGAGAATTGCTGG + Intronic
1198112866 X:133517456-133517478 ATACCTAGGAGTTGAATTGTTGG + Intergenic
1198279019 X:135124097-135124119 CTGGCTAGAAGTAGAATTGTAGG - Intergenic
1198291939 X:135248423-135248445 CTGGCTAGAAGTAGAATTGTAGG + Intergenic
1198297972 X:135305402-135305424 CTGGCTAGAAGTAGAATTGTAGG + Intronic
1198547781 X:137711296-137711318 ATGCCTAGGAGTAGAATTGTTGG - Intergenic
1198740624 X:139838561-139838583 ATGCTTAGGAGTGGAATTGTGGG - Intronic
1199337435 X:146635971-146635993 ATACCCAGGAGTAGAATTGTTGG - Intergenic
1199395870 X:147336784-147336806 ATGCCTTGGAGTAGAATTGCTGG - Intergenic
1199507558 X:148582721-148582743 ATACTTAGGAGTAAAATTGCTGG - Intronic
1199914270 X:152321973-152321995 ATACCTAGGAGTGGAATTGTGGG - Intronic
1200096193 X:153664532-153664554 ATACCTAGGAGTAGAATTGCTGG - Intergenic
1200523099 Y:4236248-4236270 CTGCTGAGGAGGGGCATTGTGGG - Intergenic
1200545441 Y:4513432-4513454 ATACCTAGGAGTAGAATTGATGG + Intergenic
1202275429 Y:23113891-23113913 ATGTGTAGGAGTAGAATTGCTGG - Intergenic
1202290599 Y:23306800-23306822 ATGTGTAGGAGTAGAATTGCTGG + Intergenic
1202428421 Y:24747610-24747632 ATGTGTAGGAGTAGAATTGCTGG - Intergenic
1202442370 Y:24922479-24922501 ATGTGTAGGAGTAGAATTGCTGG + Intergenic