ID: 1123911451

View in Genome Browser
Species Human (GRCh38)
Location 15:24972026-24972048
Sequence CCGGCAGGTCACCTGAAGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 72512
Summary {0: 2, 1: 29, 2: 1273, 3: 19008, 4: 52200}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123911444_1123911451 8 Left 1123911444 15:24971995-24972017 CCTGTAATCCTAGCACTTGGGGA 0: 149
1: 24201
2: 317814
3: 257441
4: 148888
Right 1123911451 15:24972026-24972048 CCGGCAGGTCACCTGAAGTCAGG 0: 2
1: 29
2: 1273
3: 19008
4: 52200
1123911446_1123911451 0 Left 1123911446 15:24972003-24972025 CCTAGCACTTGGGGAGGCTGAGG 0: 616
1: 93969
2: 217589
3: 253745
4: 388439
Right 1123911451 15:24972026-24972048 CCGGCAGGTCACCTGAAGTCAGG 0: 2
1: 29
2: 1273
3: 19008
4: 52200

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123911451 Original CRISPR CCGGCAGGTCACCTGAAGTC AGG Intronic
Too many off-targets to display for this crispr