ID: 1123912457

View in Genome Browser
Species Human (GRCh38)
Location 15:24981658-24981680
Sequence ACTAAGCATTATTATGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123912457_1123912461 20 Left 1123912457 15:24981658-24981680 CCATACACATAATAATGCTTAGT No data
Right 1123912461 15:24981701-24981723 TTTTCATGGGATTTTTGTAGTGG No data
1123912457_1123912458 -7 Left 1123912457 15:24981658-24981680 CCATACACATAATAATGCTTAGT No data
Right 1123912458 15:24981674-24981696 GCTTAGTATATAATAAAGCAAGG No data
1123912457_1123912462 21 Left 1123912457 15:24981658-24981680 CCATACACATAATAATGCTTAGT No data
Right 1123912462 15:24981702-24981724 TTTCATGGGATTTTTGTAGTGGG No data
1123912457_1123912459 6 Left 1123912457 15:24981658-24981680 CCATACACATAATAATGCTTAGT No data
Right 1123912459 15:24981687-24981709 TAAAGCAAGGTATATTTTCATGG No data
1123912457_1123912460 7 Left 1123912457 15:24981658-24981680 CCATACACATAATAATGCTTAGT No data
Right 1123912460 15:24981688-24981710 AAAGCAAGGTATATTTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123912457 Original CRISPR ACTAAGCATTATTATGTGTA TGG (reversed) Intergenic
No off target data available for this crispr