ID: 1123917757

View in Genome Browser
Species Human (GRCh38)
Location 15:25049360-25049382
Sequence TTTCACATGCAGGATGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123917757_1123917762 17 Left 1123917757 15:25049360-25049382 CCATGCCCATCCTGCATGTGAAA No data
Right 1123917762 15:25049400-25049422 ATGCAAATATTTCTCTCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123917757 Original CRISPR TTTCACATGCAGGATGGGCA TGG (reversed) Intergenic
No off target data available for this crispr