ID: 1123922243

View in Genome Browser
Species Human (GRCh38)
Location 15:25078537-25078559
Sequence ATTTCAATGGGGAGAGCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123922243_1123922250 18 Left 1123922243 15:25078537-25078559 CCTGCAGCTCTCCCCATTGAAAT No data
Right 1123922250 15:25078578-25078600 TTCTCTGATGGCCAAGAGAATGG No data
1123922243_1123922249 6 Left 1123922243 15:25078537-25078559 CCTGCAGCTCTCCCCATTGAAAT No data
Right 1123922249 15:25078566-25078588 ATGGCTGTTGTCTTCTCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123922243 Original CRISPR ATTTCAATGGGGAGAGCTGC AGG (reversed) Intergenic
No off target data available for this crispr