ID: 1123923848

View in Genome Browser
Species Human (GRCh38)
Location 15:25089694-25089716
Sequence AACATGGACGTGCATCAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123923848_1123923857 17 Left 1123923848 15:25089694-25089716 CCTTTCTGATGCACGTCCATGTT No data
Right 1123923857 15:25089734-25089756 GTGGTGTTGGTATAAAAAGCAGG No data
1123923848_1123923852 4 Left 1123923848 15:25089694-25089716 CCTTTCTGATGCACGTCCATGTT No data
Right 1123923852 15:25089721-25089743 CTGCACCTCCCCGGTGGTGTTGG No data
1123923848_1123923850 -5 Left 1123923848 15:25089694-25089716 CCTTTCTGATGCACGTCCATGTT No data
Right 1123923850 15:25089712-25089734 ATGTTTTCTCTGCACCTCCCCGG No data
1123923848_1123923851 -2 Left 1123923848 15:25089694-25089716 CCTTTCTGATGCACGTCCATGTT No data
Right 1123923851 15:25089715-25089737 TTTTCTCTGCACCTCCCCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123923848 Original CRISPR AACATGGACGTGCATCAGAA AGG (reversed) Intergenic
No off target data available for this crispr