ID: 1123923850

View in Genome Browser
Species Human (GRCh38)
Location 15:25089712-25089734
Sequence ATGTTTTCTCTGCACCTCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123923847_1123923850 -1 Left 1123923847 15:25089690-25089712 CCTGCCTTTCTGATGCACGTCCA No data
Right 1123923850 15:25089712-25089734 ATGTTTTCTCTGCACCTCCCCGG No data
1123923844_1123923850 20 Left 1123923844 15:25089669-25089691 CCCTTGGAACCTGTGCACATGCC No data
Right 1123923850 15:25089712-25089734 ATGTTTTCTCTGCACCTCCCCGG No data
1123923848_1123923850 -5 Left 1123923848 15:25089694-25089716 CCTTTCTGATGCACGTCCATGTT No data
Right 1123923850 15:25089712-25089734 ATGTTTTCTCTGCACCTCCCCGG No data
1123923846_1123923850 11 Left 1123923846 15:25089678-25089700 CCTGTGCACATGCCTGCCTTTCT No data
Right 1123923850 15:25089712-25089734 ATGTTTTCTCTGCACCTCCCCGG No data
1123923845_1123923850 19 Left 1123923845 15:25089670-25089692 CCTTGGAACCTGTGCACATGCCT No data
Right 1123923850 15:25089712-25089734 ATGTTTTCTCTGCACCTCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123923850 Original CRISPR ATGTTTTCTCTGCACCTCCC CGG Intergenic
No off target data available for this crispr