ID: 1123923857

View in Genome Browser
Species Human (GRCh38)
Location 15:25089734-25089756
Sequence GTGGTGTTGGTATAAAAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123923847_1123923857 21 Left 1123923847 15:25089690-25089712 CCTGCCTTTCTGATGCACGTCCA No data
Right 1123923857 15:25089734-25089756 GTGGTGTTGGTATAAAAAGCAGG No data
1123923848_1123923857 17 Left 1123923848 15:25089694-25089716 CCTTTCTGATGCACGTCCATGTT No data
Right 1123923857 15:25089734-25089756 GTGGTGTTGGTATAAAAAGCAGG No data
1123923849_1123923857 1 Left 1123923849 15:25089710-25089732 CCATGTTTTCTCTGCACCTCCCC No data
Right 1123923857 15:25089734-25089756 GTGGTGTTGGTATAAAAAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123923857 Original CRISPR GTGGTGTTGGTATAAAAAGC AGG Intergenic
No off target data available for this crispr