ID: 1123924850

View in Genome Browser
Species Human (GRCh38)
Location 15:25097979-25098001
Sequence ACAGGAGTTATAGGATTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123924846_1123924850 -4 Left 1123924846 15:25097960-25097982 CCAGACACTGGGAGCCAGCACAG No data
Right 1123924850 15:25097979-25098001 ACAGGAGTTATAGGATTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123924850 Original CRISPR ACAGGAGTTATAGGATTTAC AGG Intergenic