ID: 1123927622

View in Genome Browser
Species Human (GRCh38)
Location 15:25133850-25133872
Sequence TTTTACATGGACAAGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123927622_1123927631 3 Left 1123927622 15:25133850-25133872 CCCTCCTCCTTGTCCATGTAAAA No data
Right 1123927631 15:25133876-25133898 GGTGGGTGAAGAGATGGACAAGG No data
1123927622_1123927630 -3 Left 1123927622 15:25133850-25133872 CCCTCCTCCTTGTCCATGTAAAA No data
Right 1123927630 15:25133870-25133892 AAAGTTGGTGGGTGAAGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123927622 Original CRISPR TTTTACATGGACAAGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr