ID: 1123927658

View in Genome Browser
Species Human (GRCh38)
Location 15:25134060-25134082
Sequence GTATGGACACAGGGTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123927650_1123927658 25 Left 1123927650 15:25134012-25134034 CCAAGGTGTTATCTGAGCTCATG No data
Right 1123927658 15:25134060-25134082 GTATGGACACAGGGTGAGGTTGG No data
1123927654_1123927658 -7 Left 1123927654 15:25134044-25134066 CCAAGAAAATTAAGGAGTATGGA No data
Right 1123927658 15:25134060-25134082 GTATGGACACAGGGTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123927658 Original CRISPR GTATGGACACAGGGTGAGGT TGG Intergenic
No off target data available for this crispr