ID: 1123929916 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 15:25161766-25161788 |
Sequence | CTGTGTTATTGGCAGATGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1123929910_1123929916 | 27 | Left | 1123929910 | 15:25161716-25161738 | CCTCGCTAGCTAAGTTGCAATAT | No data | ||
Right | 1123929916 | 15:25161766-25161788 | CTGTGTTATTGGCAGATGGAAGG | No data | ||||
1123929912_1123929916 | 2 | Left | 1123929912 | 15:25161741-25161763 | CCAACTGAAGTAAAATATTTGGG | No data | ||
Right | 1123929916 | 15:25161766-25161788 | CTGTGTTATTGGCAGATGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1123929916 | Original CRISPR | CTGTGTTATTGGCAGATGGA AGG | Intergenic | ||
No off target data available for this crispr |