ID: 1123929916

View in Genome Browser
Species Human (GRCh38)
Location 15:25161766-25161788
Sequence CTGTGTTATTGGCAGATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123929910_1123929916 27 Left 1123929910 15:25161716-25161738 CCTCGCTAGCTAAGTTGCAATAT No data
Right 1123929916 15:25161766-25161788 CTGTGTTATTGGCAGATGGAAGG No data
1123929912_1123929916 2 Left 1123929912 15:25161741-25161763 CCAACTGAAGTAAAATATTTGGG No data
Right 1123929916 15:25161766-25161788 CTGTGTTATTGGCAGATGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123929916 Original CRISPR CTGTGTTATTGGCAGATGGA AGG Intergenic
No off target data available for this crispr