ID: 1123930170

View in Genome Browser
Species Human (GRCh38)
Location 15:25164922-25164944
Sequence TATCCCAGCCCAAATGGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123930166_1123930170 27 Left 1123930166 15:25164872-25164894 CCATGGGGGTCCAATTTAATAAA No data
Right 1123930170 15:25164922-25164944 TATCCCAGCCCAAATGGTGAGGG No data
1123930167_1123930170 17 Left 1123930167 15:25164882-25164904 CCAATTTAATAAAGCTTAAATAG No data
Right 1123930170 15:25164922-25164944 TATCCCAGCCCAAATGGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123930170 Original CRISPR TATCCCAGCCCAAATGGTGA GGG Intergenic
No off target data available for this crispr