ID: 1123934389

View in Genome Browser
Species Human (GRCh38)
Location 15:25187104-25187126
Sequence CCCGGGCTGTGCCCTACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123934389_1123934395 -4 Left 1123934389 15:25187104-25187126 CCTGCAGTAGGGCACAGCCCGGG No data
Right 1123934395 15:25187123-25187145 CGGGGGTCTTGCCTGAGCCCAGG No data
1123934389_1123934406 30 Left 1123934389 15:25187104-25187126 CCTGCAGTAGGGCACAGCCCGGG No data
Right 1123934406 15:25187157-25187179 CCTGTCCTTCCATGGTTCGGTGG No data
1123934389_1123934403 27 Left 1123934389 15:25187104-25187126 CCTGCAGTAGGGCACAGCCCGGG No data
Right 1123934403 15:25187154-25187176 GGCCCTGTCCTTCCATGGTTCGG No data
1123934389_1123934396 6 Left 1123934389 15:25187104-25187126 CCTGCAGTAGGGCACAGCCCGGG No data
Right 1123934396 15:25187133-25187155 GCCTGAGCCCAGGATCCTGCCGG No data
1123934389_1123934401 22 Left 1123934389 15:25187104-25187126 CCTGCAGTAGGGCACAGCCCGGG No data
Right 1123934401 15:25187149-25187171 CTGCCGGCCCTGTCCTTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123934389 Original CRISPR CCCGGGCTGTGCCCTACTGC AGG (reversed) Intergenic
No off target data available for this crispr