ID: 1123934944

View in Genome Browser
Species Human (GRCh38)
Location 15:25189582-25189604
Sequence GCACCCCGAAGGTGTCCTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123934944_1123934953 29 Left 1123934944 15:25189582-25189604 CCTGAAGGACACCTTCGGGGTGC No data
Right 1123934953 15:25189634-25189656 GCAGCCAAGGCTCCTTGTGCAGG No data
1123934944_1123934950 7 Left 1123934944 15:25189582-25189604 CCTGAAGGACACCTTCGGGGTGC No data
Right 1123934950 15:25189612-25189634 AGTCTCTGCACTCCTCTGTGTGG No data
1123934944_1123934951 16 Left 1123934944 15:25189582-25189604 CCTGAAGGACACCTTCGGGGTGC No data
Right 1123934951 15:25189621-25189643 ACTCCTCTGTGTGGCAGCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123934944 Original CRISPR GCACCCCGAAGGTGTCCTTC AGG (reversed) Intergenic
No off target data available for this crispr