ID: 1123935461

View in Genome Browser
Species Human (GRCh38)
Location 15:25191942-25191964
Sequence CTGCAGCCCTGCAGTGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123935455_1123935461 25 Left 1123935455 15:25191894-25191916 CCAAGAGGGCTGTTTTTTTGGGA No data
Right 1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG No data
1123935458_1123935461 -4 Left 1123935458 15:25191923-25191945 CCCAAGGATGATATCTTTCCTGC No data
Right 1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG No data
1123935452_1123935461 28 Left 1123935452 15:25191891-25191913 CCTCCAAGAGGGCTGTTTTTTTG No data
Right 1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG No data
1123935459_1123935461 -5 Left 1123935459 15:25191924-25191946 CCAAGGATGATATCTTTCCTGCA No data
Right 1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123935461 Original CRISPR CTGCAGCCCTGCAGTGATGA CGG Intergenic
No off target data available for this crispr