ID: 1123937265

View in Genome Browser
Species Human (GRCh38)
Location 15:25200004-25200026
Sequence CTGGAGCCCTGCAGTGATGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 1, 2: 1, 3: 41, 4: 273}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123937259_1123937265 -4 Left 1123937259 15:25199985-25200007 CCCAAGGGGGACGCCTTCCCTGG 0: 1
1: 0
2: 2
3: 16
4: 131
Right 1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG 0: 1
1: 1
2: 1
3: 41
4: 273
1123937251_1123937265 28 Left 1123937251 15:25199953-25199975 CCTCCAGAAGGGTGGCTTCCTGA 0: 1
1: 0
2: 1
3: 14
4: 198
Right 1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG 0: 1
1: 1
2: 1
3: 41
4: 273
1123937252_1123937265 25 Left 1123937252 15:25199956-25199978 CCAGAAGGGTGGCTTCCTGAGAA 0: 1
1: 0
2: 6
3: 86
4: 261
Right 1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG 0: 1
1: 1
2: 1
3: 41
4: 273
1123937256_1123937265 10 Left 1123937256 15:25199971-25199993 CCTGAGAAATCGGACCCAAGGGG 0: 1
1: 0
2: 0
3: 5
4: 81
Right 1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG 0: 1
1: 1
2: 1
3: 41
4: 273
1123937261_1123937265 -5 Left 1123937261 15:25199986-25200008 CCAAGGGGGACGCCTTCCCTGGA 0: 1
1: 0
2: 4
3: 11
4: 119
Right 1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG 0: 1
1: 1
2: 1
3: 41
4: 273

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123937265 Original CRISPR CTGGAGCCCTGCAGTGATGA CGG Intergenic
900200186 1:1401183-1401205 ATGAAGGCCTGCAGTGAGGATGG + Intronic
900736447 1:4302340-4302362 ATGGGGCCCTGCAGAAATGAGGG - Intergenic
900798163 1:4721940-4721962 CCGGACCCCTCCAGTGAAGATGG - Intronic
901126201 1:6930572-6930594 CTGGGGAACAGCAGTGATGAGGG - Intronic
901781617 1:11598228-11598250 CTGGAGTCCCACAGTGTTGAAGG + Intergenic
901871807 1:12142776-12142798 CTGGATCCCAGCAGTGATGTTGG + Exonic
902353326 1:15876187-15876209 CTGAAGCCCTGCATTTAGGAGGG - Exonic
903058651 1:20654324-20654346 CTGGAGCCCAGCAATGAGGAGGG + Exonic
903232136 1:21928296-21928318 CTGGGGCCCTGCAGAGAGCATGG + Intronic
903438948 1:23372669-23372691 CAGCAGCCCTGCAGTCGTGAGGG - Intergenic
904163493 1:28537896-28537918 CTGGAGCCCTGTGGAGATGATGG + Exonic
906748641 1:48239417-48239439 CCGGAGGCCAGCAGTGCTGAAGG + Exonic
907443120 1:54490524-54490546 CAGGAGCCCTGCAGGGAGGGAGG - Intergenic
909125123 1:71658042-71658064 CTGGAGCTGTGCAGGGATCATGG - Intronic
914832573 1:151181179-151181201 CTGTGGCCATGCAGTGTTGAAGG - Intronic
915318603 1:155043554-155043576 CTGGAGCCCTGCCCTGAGGGAGG + Intronic
915603444 1:156936815-156936837 CTGGGGCCCTGCCCTGAGGATGG - Exonic
915822571 1:159041000-159041022 CTGCAGCCTTTCAGTGATGGAGG + Intronic
918309005 1:183272238-183272260 CTGGATGCCTGCATTGATGCTGG + Intronic
918323665 1:183389171-183389193 CTGGGGACCTGCAGTGCTGGAGG - Intronic
920053122 1:203175326-203175348 CTGGAGCTCTGCAGAGAGGGAGG - Exonic
920181383 1:204134090-204134112 CTGAAGCCATGCAGTGGTTAAGG - Intronic
921357895 1:214303805-214303827 CTGCAGCCCAGCAGAGCTGACGG - Intronic
924029183 1:239869296-239869318 CTTGAGCCCTAAAATGATGAAGG + Intronic
924955678 1:248924273-248924295 CTGGAAGCCAGCAGTCATGAAGG - Intergenic
1063161721 10:3423445-3423467 CTGCAGCTCTGCAGAGCTGAGGG - Intergenic
1063629245 10:7718861-7718883 CTGCTCCCCTGCGGTGATGATGG - Intronic
1064035376 10:11909668-11909690 CAGGAACCCTCCAGTGAGGACGG + Intergenic
1066031860 10:31435738-31435760 GTGGAGCCTTGCAGGAATGATGG + Intronic
1066228059 10:33403828-33403850 CTGGAGCACAGCAGTGAGGTGGG + Intergenic
1068939926 10:62670714-62670736 GTGGAGCCCTTCAGAGATGTAGG - Exonic
1069058244 10:63866849-63866871 CTGGGGCCTGGCAGTAATGATGG + Intergenic
1069954694 10:72042797-72042819 CTGGGGCCCTGCAGCTATGGGGG - Intergenic
1070797670 10:79226285-79226307 CTGGTGACCTGCAGAGATGCAGG - Intronic
1070849952 10:79555552-79555574 CTGCAGCCCAGCAGTGATGTTGG - Intergenic
1070854209 10:79593642-79593664 CTGCAGCCCAGCAGTGATGGTGG - Intergenic
1070857249 10:79615735-79615757 CTGCAGCCCAGCAGTGATGGTGG + Intergenic
1071100365 10:82029743-82029765 CAGGAGCCCTGCAGTGAAGATGG + Intronic
1071388651 10:85147661-85147683 CTGCAGCCCTGCAGAAAAGAGGG - Intergenic
1071562520 10:86655237-86655259 ATGGAGCCCTCCAGGGAGGAGGG + Intronic
1072374868 10:94804115-94804137 CTGGAGCTCTGCTTTGAGGATGG + Intronic
1076057273 10:127386042-127386064 CTGATGCCCGGGAGTGATGATGG + Intronic
1076243835 10:128931013-128931035 CTGGAGCCCTGCAGGGACACAGG - Intergenic
1076886832 10:133266902-133266924 CTGGAGCCCTGGCATGCTGAGGG - Intronic
1077128051 11:953015-953037 CAGCACCCCTGCAGTCATGACGG - Intronic
1077466562 11:2736348-2736370 TTGGAGCCCTGGAGTGCCGAGGG + Intronic
1078092792 11:8277761-8277783 CTGGAGACCTGGAGTGATCCTGG + Intergenic
1078444851 11:11396411-11396433 ATGGAGAGCTGCAGGGATGATGG + Intronic
1079057727 11:17221068-17221090 CTGAAGCTCTACAGTGATGGAGG + Intronic
1080245242 11:30172785-30172807 CTGGAATCGTGCAGTGGTGATGG - Intergenic
1081496050 11:43611559-43611581 CTGGAAGTCTGCAGTTATGAAGG - Intronic
1083430438 11:62611449-62611471 CCAGAGCCCTGCAGGGAGGAAGG + Exonic
1083439150 11:62664781-62664803 CCGGAGCTCTGCAGGGAGGAAGG + Intronic
1083734157 11:64670121-64670143 CTGGAGCCTCGCAGTGAATAGGG + Intronic
1083737657 11:64690802-64690824 CTGGGGGCCTCCAGTGCTGAGGG - Intronic
1083826238 11:65205540-65205562 CTGGGGCCCTGCTGTGGTGCAGG + Intronic
1084269601 11:68021914-68021936 CTTGGGCCCTCCAGTGAGGAGGG - Intronic
1085052981 11:73389221-73389243 CTGGAGGGCTGCAGGGCTGAGGG - Intronic
1085270899 11:75269263-75269285 CTGGAGCCCCGCAGTGACCACGG - Intronic
1086198413 11:84170097-84170119 CTGGAGACCTGCTTTGATCAAGG - Intronic
1086206249 11:84261443-84261465 ATTGAGTCCTGGAGTGATGATGG - Intronic
1087159367 11:94934212-94934234 CTGAATCCCTGCAGTGATGTGGG + Intergenic
1089383440 11:118052368-118052390 CTGGGGCCCTGCAGGGAAGCAGG + Intergenic
1089494128 11:118899922-118899944 CCGGAGCCCTGCGGTGGTGGTGG + Exonic
1090349889 11:126101239-126101261 CTGTGGCCCTCGAGTGATGATGG - Intergenic
1090627768 11:128620926-128620948 CTGGAGCCTCGCAGAGAGGAGGG - Intergenic
1090678107 11:129024032-129024054 CTGGAACCCGGCAGTGATGTGGG - Intronic
1091845947 12:3656530-3656552 CCAGAGCCCTGCAGTGCTGTGGG - Intronic
1093546878 12:20359204-20359226 ATGGAGCACTCCAGTGAGGAAGG + Intergenic
1095255183 12:40026522-40026544 CTCTAGCCATGCAGTGTTGACGG - Intronic
1095259659 12:40083540-40083562 CTGCAGTGCTGCAGTGGTGATGG - Intronic
1096629429 12:52916295-52916317 CTGGAGGCCTGCAGTGTGGTAGG + Intronic
1099459871 12:82909316-82909338 CTGGAGTCCTGCATTCATGAAGG + Intronic
1100734280 12:97509724-97509746 CAGGAGCCCTGGATTGATGGAGG + Intergenic
1102541445 12:113622332-113622354 CTGGAGGCCTGCAGGGAAGCTGG + Intergenic
1102762728 12:115402817-115402839 CTAAAGCACTTCAGTGATGAAGG + Intergenic
1103325608 12:120117729-120117751 CTGCAGTTCTGCAGTGAGGATGG - Intergenic
1104000681 12:124857920-124857942 CTGCAGCCCAGCAGTAGTGAGGG + Intronic
1104798290 12:131535202-131535224 ATGTGGCCCTGCAGTGATGGAGG + Intergenic
1104958138 12:132475746-132475768 CAGGAGACCTGCAGTGAGGCTGG - Intergenic
1105047154 12:133014493-133014515 CTGACACCCAGCAGTGATGATGG + Exonic
1105533340 13:21240804-21240826 CTGGAGCTGTTAAGTGATGATGG - Intergenic
1108070192 13:46620593-46620615 CGGGAGCCATGCAGTGGTGAAGG + Intronic
1109217479 13:59606067-59606089 ATGGAGACCTGGAGAGATGAGGG + Intergenic
1109316082 13:60751504-60751526 ATGAAGCACTGCAGTGATGTGGG + Intergenic
1110758854 13:79207947-79207969 CTCAGGCCCTGCAGGGATGAAGG + Intergenic
1112595708 13:100805138-100805160 CTGGATCCCTGGAGGGATGGAGG - Intergenic
1112628834 13:101138548-101138570 CTGGAGCCATGCTAGGATGAGGG - Intronic
1113574239 13:111382803-111382825 TGGGAGCCCTGCAGAGATGATGG + Intergenic
1113612731 13:111659047-111659069 CTGGCGCCCCTCAGTAATGAAGG - Intronic
1114220008 14:20688045-20688067 CTACAGCCCTGCTTTGATGATGG + Intronic
1114332439 14:21651035-21651057 CTTGGGCCCTTCAGGGATGAAGG - Intergenic
1114520101 14:23328376-23328398 CAGGACCCCTGCAATGATGATGG - Intergenic
1119294583 14:73522636-73522658 CTGGATGCATGCAGGGATGATGG + Exonic
1121048265 14:90803483-90803505 CAGGAGCCCTGCAGTGGGAATGG - Intronic
1121478930 14:94244212-94244234 CTGAAGGCCTACAGTGATGTCGG - Intronic
1122495930 14:102155382-102155404 CTGGAGCCCTGCAAGGATAAGGG + Intronic
1122814664 14:104306608-104306630 CTGGACCCCTGCAGAGTTGGAGG + Intergenic
1123930907 15:25171268-25171290 CTAAAGCCCTGCAGTGGTGAGGG + Intergenic
1123931784 15:25175460-25175482 CTGAAGCCCTGCAGGGGTGACGG + Intergenic
1123932655 15:25179283-25179305 CTGAAGCCGTGCAGAGATGATGG + Intergenic
1123933029 15:25181008-25181030 CTGCAGCCCTGCGGGGATGACGG + Intergenic
1123933461 15:25182925-25182947 CTGAAGCCCTGCAGGGGTGACGG + Intergenic
1123934172 15:25186175-25186197 CTGGAGCCCTGCAGGGGTGGTGG + Intergenic
1123935461 15:25191942-25191964 CTGCAGCCCTGCAGTGATGACGG + Intergenic
1123935885 15:25193872-25193894 CTGAAGCCCTGCAGGGGTGACGG + Intergenic
1123937265 15:25200004-25200026 CTGGAGCCCTGCAGTGATGACGG + Intergenic
1123938117 15:25203777-25203799 CTGAAGCCCTGCAGGGGTGATGG + Intergenic
1123940467 15:25214194-25214216 CTGAAGCCCTGCAAGGGTGATGG + Intergenic
1123941570 15:25219148-25219170 CTGAAGCCCTGAAGGGGTGATGG + Intergenic
1123943845 15:25229509-25229531 CTGAAGCCCTGCCGGGGTGATGG + Intergenic
1123945019 15:25234795-25234817 CTGAAGCCCTACTGGGATGATGG + Intergenic
1123945426 15:25236629-25236651 CTGAAGCCCTGCAGGGGTGATGG + Intergenic
1123946269 15:25240388-25240410 CTGAAGCCCTGCAGGGGTGATGG + Intergenic
1123946699 15:25242293-25242315 CTGAAGCCCTGCAAGGGTGATGG + Intergenic
1123947530 15:25246022-25246044 CTGAAGCCCTGCAGGGGTGACGG + Intergenic
1123948346 15:25249738-25249760 CTGAAGCCCTGCAAAGGTGATGG + Intergenic
1124244300 15:28056676-28056698 GTGGAGCTCAGCAGTGATGCAGG - Intronic
1124661348 15:31553278-31553300 CTGGGGCCCTACAGTATTGAGGG - Intronic
1124847344 15:33304321-33304343 CAGGAGGCCTGCAGTGCTGCTGG - Intergenic
1125610276 15:40964787-40964809 CAGGAGGCAGGCAGTGATGAGGG + Intergenic
1127661050 15:61100515-61100537 CTGGAGCCCTGAAGTGGAGAAGG - Intronic
1128541390 15:68536912-68536934 CTGGAGCCAGGAAGTGATGCTGG + Intergenic
1130071365 15:80649129-80649151 CTGGAGCGATGCAGAGAAGATGG + Intergenic
1130247113 15:82262383-82262405 CTGGGACCCTGCAGAAATGAAGG - Intronic
1132329860 15:101004742-101004764 CTGGAGCCCTGAACTGCAGAAGG - Intronic
1132457195 16:30704-30726 AGGGAGCACTGCAGTGATGGAGG - Intergenic
1132497188 16:269432-269454 CTGGGGCCCTGCAGTGAGGTGGG - Intronic
1132873727 16:2126720-2126742 CTGGAGCTCTGCAGTGGCCACGG - Intronic
1133110089 16:3542908-3542930 CTGTTGCCCTGGAGTGAGGAAGG - Intronic
1133570368 16:7034450-7034472 CTGGAGCCCAGCAAGGAAGAAGG - Intronic
1134552817 16:15145894-15145916 CTGGAGCTCTGCAGTGGCCACGG - Intergenic
1134568909 16:15274769-15274791 CTGGAGCCCTGCTGGGAAGGAGG + Intergenic
1134684727 16:16150527-16150549 CAGCAGCCCTGCAGTGGTGGGGG - Intronic
1134733525 16:16481593-16481615 CTGGAGCCCTGCTGGGAAGGAGG - Intergenic
1134933975 16:18230689-18230711 CTGGAGCCCTGCTGGGAAGGAGG + Intergenic
1136247575 16:28984594-28984616 CAGGAGCCCTGGGGTGAAGACGG - Intergenic
1136454844 16:30374633-30374655 CTGGAGCCCAGCGGGGAGGAAGG - Intronic
1138239855 16:55418697-55418719 CTAGATCCCTGCAGAGGTGAGGG - Intronic
1138347470 16:56328817-56328839 CTGGAGCCGGGCAGTGATGCGGG + Intronic
1139344762 16:66295862-66295884 CTGCAGCCTTGCAGAGAAGAGGG + Intergenic
1142082392 16:88157083-88157105 CAGGAGCCCTGCAGAGGGGAGGG - Intergenic
1142132237 16:88436357-88436379 CTGGAGCCCAGCAGGGAAGCTGG + Exonic
1143362717 17:6384669-6384691 CTGGAGCCATGGAGTGGGGAGGG - Intergenic
1143725063 17:8838991-8839013 CTGCAGGCCTGGAGTGCTGAGGG + Intronic
1144581509 17:16461948-16461970 CTCCAGCCCTGCAGAAATGAGGG + Intronic
1144653168 17:17019544-17019566 CAGGTGCCCTGCAGTGAAAATGG - Intergenic
1146307789 17:31743919-31743941 CTGGAGCCAGGCAGTGGGGATGG - Intergenic
1146835418 17:36106827-36106849 CTGGGGCTCTGGAATGATGAGGG - Intergenic
1147162716 17:38577462-38577484 CTTGTTCCCTGCAGTGAGGATGG + Intronic
1148233771 17:45953671-45953693 CTCTAGCCCTGCAGGGATGGTGG + Intronic
1148777510 17:50104011-50104033 CTAGAGCCCTGCAGTGCCAAGGG - Intronic
1149548340 17:57521134-57521156 CTGGAAGACTGCAGTGATGAAGG - Intronic
1151185383 17:72360446-72360468 CAGCAGCCTTGCAGTGAGGAGGG - Intergenic
1152065765 17:78111915-78111937 CTGGAGCACTGGGGTCATGACGG + Exonic
1152065777 17:78111954-78111976 CTGGAGCACTGGGGTCATGACGG + Exonic
1152065797 17:78112028-78112050 CTGGAGCACTGGGGTCATGACGG + Exonic
1152065836 17:78112174-78112196 CTGGAGCACTGGGGTCATGACGG + Exonic
1152280481 17:79382305-79382327 CTGCATCCCTGCAGGGATGGGGG + Intronic
1152317536 17:79589692-79589714 CTGGAGAACGGCAGTGAAGAGGG + Intergenic
1154215662 18:12414344-12414366 TTGGAGCCCTGCCTTGATGCTGG + Intronic
1154301327 18:13195206-13195228 CTGTATCCCTGCAGTGAGGTGGG + Intergenic
1156154022 18:34280457-34280479 CTGGAGCAATGCAGTTCTGATGG + Intergenic
1159554704 18:69933077-69933099 CTGTGGCCCTGCAGTGAGGGAGG - Intronic
1160442379 18:78902441-78902463 CGGGTGCCCTGCAGGGCTGAAGG - Intergenic
1160658872 19:289099-289121 CTGGGGCCCTGCTGAGCTGAGGG + Intronic
1161505433 19:4641009-4641031 CTGGACCCCTGCAGGGAATATGG + Intronic
1162502586 19:11062461-11062483 CTGGAGACCTGCAGTGGCAAAGG - Intronic
1163650711 19:18516116-18516138 CTGGGGCCCTGCTGTGAGAATGG + Intronic
1163841807 19:19615990-19616012 CTAGAGCCCTGTAGTGGGGAGGG - Intronic
1164468087 19:28505173-28505195 CTGGAGCCCCCCATTGCTGAGGG - Intergenic
1165715704 19:38044479-38044501 ATGGACCCCTGCAGTGAGGCAGG + Intronic
1166679239 19:44757200-44757222 CTGGAGGCCCGCAATTATGACGG + Exonic
1166898568 19:46040335-46040357 TTGGAGCAGTGCTGTGATGACGG - Exonic
1167207495 19:48112433-48112455 CTGGGGCCCTGCACTGGTGCAGG + Intergenic
925847035 2:8043717-8043739 CTGCATCCCTGCAGTGATAGTGG - Intergenic
925905963 2:8539806-8539828 CTGGGGCCCTGCAGCGAGGACGG - Intergenic
926311084 2:11676854-11676876 CTGGAGAGCTGTCGTGATGATGG + Intergenic
927637569 2:24827367-24827389 CTGCAGCAGTGCAGTGAGGAGGG - Intronic
927848523 2:26484626-26484648 CTGGTGCTCTGCAATGATGAGGG + Exonic
927910512 2:26894861-26894883 ATGGAGCCATGCAGTGAAGTGGG - Intronic
928252119 2:29690177-29690199 CTGGAGCCCTGGAGTGGCTAAGG - Intronic
930024824 2:47023649-47023671 CTGGAGCCCCCCAGAGCTGAAGG - Intronic
931248395 2:60509833-60509855 CTGAAGTCCTGAAGTGGTGAAGG + Intronic
931514191 2:63033099-63033121 CTGGAGTCCTGCAATAATGTTGG + Intronic
933697584 2:85231415-85231437 CTGAACACCTGCAGTGATGGGGG + Intronic
934038460 2:88108242-88108264 CAGAAGCCTTGCAGTGCTGAGGG + Intronic
934679322 2:96271286-96271308 CTGGCCTCCTGCAGTGATGATGG + Exonic
934751958 2:96799419-96799441 CTGGAGCCCTGGAGAGCTCAGGG - Intronic
937096747 2:119240627-119240649 CTGTAGCCCTGCCGGGAAGAAGG + Intronic
937289925 2:120776027-120776049 CTGGGGCCCTGCCTTGCTGATGG - Intronic
937910237 2:127072110-127072132 CTGGAGCGCTGCAGGCATGCTGG - Intronic
938236422 2:129710004-129710026 CTGGAGGCCTGCAATCCTGATGG + Intergenic
938906017 2:135836792-135836814 CTGAAGCCGTGCAGTCTTGAGGG + Exonic
939464391 2:142538743-142538765 CTGGCGCCCTGTGCTGATGAAGG - Intergenic
940997697 2:160167882-160167904 CTGGAGCCTTGCTGTGGAGAAGG + Intronic
946419415 2:219556578-219556600 CTGGGGCCCTGGAGTGACGACGG + Exonic
948758045 2:240170418-240170440 CTGGAACTCTGCACTGAGGAAGG - Intergenic
948776760 2:240293224-240293246 CTGGAGGCCTGCAGTGCCCAGGG + Intergenic
1171374778 20:24685153-24685175 CCTGAGCCCTGCAGAGGTGAAGG - Intergenic
1172274245 20:33671150-33671172 CTTGTGCCCTGCAGTGAGGCTGG - Intronic
1172314566 20:33943758-33943780 CTGGAGGAGTGGAGTGATGATGG + Intergenic
1175521614 20:59605492-59605514 CTGGGGCCCGGCAGTGGGGAGGG - Intronic
1180140481 21:45890497-45890519 CTGGAACTCTGCACTGCTGAGGG + Intronic
1180140534 21:45890962-45890984 CTGGAACTCTGCACTGCTGAGGG + Intronic
1180173911 21:46078345-46078367 CTGGAGCATTGCAGTGAGGCCGG + Intergenic
1181086266 22:20440872-20440894 GTGCAGCCCTGCAGTGAGGCTGG + Intronic
1181102674 22:20551933-20551955 CTGGCTCCCTGCTGTGCTGAGGG + Intronic
1182280314 22:29214570-29214592 CAAGAGCCAGGCAGTGATGATGG + Intronic
1182892592 22:33831452-33831474 GGGGAGCCCTGCCGTGAGGACGG + Intronic
1183498405 22:38163491-38163513 CAGGAGCCCTGCAGTCTGGAGGG + Intronic
1184500792 22:44870399-44870421 CTGGAGCCCTGAAGCAGTGAGGG - Intergenic
1184596776 22:45518699-45518721 CTGGAGGCCTGCTGTGCGGACGG + Exonic
1185158273 22:49207290-49207312 CTGGTGCCTTGCAGGGCTGAGGG - Intergenic
949158883 3:857827-857849 CTGGAGACCTGCAGAGAAGCCGG - Intergenic
949893197 3:8748496-8748518 CTGAAGCCCTGCAGGGATCTGGG + Intronic
950201698 3:11048996-11049018 CTGGATCCCTGGAGGAATGAAGG + Intergenic
950459397 3:13112264-13112286 CTGGAGCTCTGCAGTGGACAGGG + Intergenic
951532489 3:23710804-23710826 CTGGAGACCTGGGGTGATCAAGG + Intergenic
952259122 3:31722362-31722384 CTTGTGCCCTGCAGACATGAGGG - Intronic
952899211 3:38098530-38098552 CTGCAGCCATGCCGTGGTGAAGG - Intronic
952978331 3:38715096-38715118 CTGGAGCCTTGCATGAATGAAGG - Intronic
954378458 3:50206853-50206875 CTGGAGCCCTGGACTGGTGTGGG - Intronic
954390202 3:50264729-50264751 CTGGAGCCCGGCAGGGTGGAGGG - Intergenic
954952928 3:54490850-54490872 CTTGAGCCCTGCAGGTGTGATGG + Intronic
955101988 3:55859363-55859385 TTGAAGCCCTGCAGGAATGAAGG - Intronic
957450694 3:80378135-80378157 CTGGAGCCCTGCCAGGGTGATGG - Intergenic
958516339 3:95121068-95121090 CTGGAGCCCTGGAGGCATGAGGG + Intergenic
961077595 3:123996371-123996393 CTGGGGCTGAGCAGTGATGATGG + Intergenic
961306983 3:125964909-125964931 CTGGGGCTGAGCAGTGATGATGG - Intergenic
963382341 3:144547428-144547450 CTGCAGACTTGCAGTGATGTGGG + Intergenic
963798844 3:149657713-149657735 CTGGAGCCCTGGAGTGGTGCCGG + Intronic
964375937 3:156049110-156049132 CTGGAGCACAGCAGGGATGGAGG + Intronic
968557335 4:1252736-1252758 CTGGGGCCGGGCAGTGATGTTGG - Intergenic
968628224 4:1637577-1637599 CAGGAGCCCTGCAGTGGGGAAGG + Intronic
969062732 4:4450793-4450815 CTGAAGCCATGCAGTGAGGCAGG - Intronic
969461567 4:7331810-7331832 CTGGACCCCTGCTGGGAGGATGG + Intronic
969695424 4:8731545-8731567 CTGAAGCCCTCCAGGGAGGAAGG + Intergenic
971233600 4:24820714-24820736 CTGACCTCCTGCAGTGATGAAGG - Intronic
972115587 4:35629073-35629095 CTTGAACCCAGCAGTAATGAGGG + Intergenic
973626372 4:52776641-52776663 TAGGAGCCCTGCTGAGATGATGG + Intergenic
981652627 4:147076803-147076825 CTGGAAGACAGCAGTGATGAGGG - Intergenic
985085413 4:186308119-186308141 CTGGAACACTGCAGTACTGAAGG - Intergenic
987136093 5:14900918-14900940 CTGGAGCCCTTCAGAGAGGAAGG + Intergenic
988686050 5:33526588-33526610 ATGGAGCCCTACAGGGATGGAGG + Exonic
991179736 5:63736043-63736065 CTGGAGCAGTGCAGTGATAATGG - Intergenic
992108244 5:73468376-73468398 CTGAAGACCTGGAGTGCTGATGG + Intergenic
993092948 5:83449774-83449796 CTGGAGCACTGCAGGTATTATGG + Intergenic
995968779 5:117941569-117941591 CTGGAGACCTGCAGAGCTAATGG - Intergenic
996691909 5:126349137-126349159 CTATAGCACTGCAGTGTTGATGG + Intergenic
997450802 5:133981543-133981565 CTGGAACTCTGCAGTCATGGGGG + Intronic
998934871 5:147224380-147224402 CTGGAGCCCCCCAGTGGAGAGGG - Intergenic
999444465 5:151628291-151628313 CTGGCTCCCTGCAGAGAGGATGG + Intergenic
1001054312 5:168436482-168436504 CTGGAGCCCTGCACTTGGGATGG - Intronic
1001090330 5:168735383-168735405 CTAGAGTCCTGGAGTGATGTGGG + Intronic
1001766556 5:174252373-174252395 CTGGAGTCCTGAAGTGGGGAAGG + Intergenic
1001783468 5:174391021-174391043 CTGGAGCTCTGAAGTGCTGTGGG - Intergenic
1002188554 5:177467325-177467347 GTGGTGCCCTGCAGTGTCGAAGG + Exonic
1002756390 6:164537-164559 ATGCTGCTCTGCAGTGATGAGGG + Intergenic
1002760428 6:197602-197624 CTGGAGCCTTGCAGGGGGGATGG - Intergenic
1002772890 6:304371-304393 TTGCAGCCCTGCAGTGCTGGTGG - Intronic
1004533611 6:16477898-16477920 CTGGAGGCCTGCCCAGATGAGGG + Intronic
1004546765 6:16605432-16605454 CTGGAGCCTTGCAGGGCTCATGG - Intronic
1004884322 6:20037041-20037063 TTGGAGCCATGCATTGATCAAGG + Intergenic
1005915173 6:30345156-30345178 CTGGAGCGCGGCGGTGATGGCGG + Exonic
1005964688 6:30718741-30718763 CTGGAGCCCTGCAAAGTTAAAGG + Intergenic
1006464560 6:34184705-34184727 ATGGGGTCTTGCAGTGATGATGG - Intergenic
1007024433 6:38556058-38556080 CTCGAGCCTTGCAGTTTTGAAGG - Intronic
1007254618 6:40520246-40520268 CTGGCGTACGGCAGTGATGAAGG + Intronic
1010951051 6:82037582-82037604 CTGGAGCCTAGGAGAGATGATGG + Intergenic
1015502096 6:133945181-133945203 CTGGAGCTCAGCCATGATGAGGG - Intergenic
1017119137 6:151007304-151007326 CTGAAGCCCTGCAGGGAAGTGGG - Intronic
1018045145 6:159959405-159959427 CAGGACCCCAGCATTGATGATGG - Intergenic
1018810174 6:167293329-167293351 CTGGGGCCCTGCAGAGAGGGAGG - Intronic
1019258639 7:67442-67464 CTGGAGGATTGCAGAGATGAGGG - Intergenic
1022124765 7:27345152-27345174 CTGGAGCCCAGCACTGAGGCTGG - Intergenic
1024253176 7:47521489-47521511 CTGGAGCCCAGGAGGCATGAGGG - Intronic
1025025740 7:55514917-55514939 CTGGGGCCGTGCAGTGCTGCTGG + Intronic
1031463396 7:122079163-122079185 CTGGAGCAGGGCAGAGATGATGG + Intronic
1031870688 7:127087194-127087216 CTGGAACCCTGCAGTGGAGAAGG - Intronic
1032083997 7:128874228-128874250 CTGGGGCCCTGCTGTGGTGAGGG - Intronic
1033321013 7:140339679-140339701 TTGGAGCCCTGCATTGCTGGTGG - Intronic
1034500065 7:151444443-151444465 CTCTGGCCCTGCTGTGATGAGGG - Intergenic
1034978204 7:155459861-155459883 CAGGGGCCCTGCAGAGATGCTGG + Intronic
1035656012 8:1305655-1305677 ATGGAGGCCTGCAGTGTTTATGG - Intergenic
1035657307 8:1319844-1319866 CTGGAGCACTGCAGTCAGCATGG + Intergenic
1035951560 8:4027559-4027581 CAGGAACCATGCAGTTATGATGG - Intronic
1038869566 8:31479609-31479631 CCTGAGCCCAGGAGTGATGAAGG - Intergenic
1042986546 8:74590187-74590209 CTGAAGCCCAGCTGTGATGCAGG - Intergenic
1043075649 8:75695493-75695515 CTGCAGCCCTGCAGTCACGGAGG - Intergenic
1043603452 8:81970194-81970216 CTGGAGCTCTGCAGTAAGAAAGG - Intergenic
1043956338 8:86364053-86364075 CTGAAGCCTTGCTGTGATGCAGG + Intronic
1045124198 8:99071847-99071869 CTGCAGACCTGGGGTGATGATGG - Intronic
1045410185 8:101909433-101909455 GTGGAGCAAGGCAGTGATGAAGG - Intronic
1046292351 8:112179741-112179763 CTGGAGCCTTACAATCATGATGG + Intergenic
1048802353 8:138206163-138206185 CTGGAGCCTTGCAGAGGTGGAGG - Intronic
1049392989 8:142381587-142381609 CAGGCGCCCAGCAGTGCTGAGGG + Intronic
1049439615 8:142603147-142603169 ATGGAGCCCTGCACAGAGGACGG + Intergenic
1049441771 8:142612872-142612894 GTGGAGCCCTGCAGGGGGGAGGG + Exonic
1050088121 9:1988346-1988368 CTTGAGCACTGCTGTGCTGAAGG - Intergenic
1050301559 9:4264016-4264038 CTGGAGCTCTGGAGTGAAGTGGG - Intronic
1053157279 9:35790519-35790541 CTGGAGCCCTGGAGTGGGGTGGG - Intergenic
1053441326 9:38118651-38118673 CTGACGCCCTGCAGTGAGGCAGG - Intergenic
1054474472 9:65562980-65563002 CTGGAGATGTCCAGTGATGAAGG + Intergenic
1054804755 9:69387079-69387101 CTGGAGCCCTCCATTGTGGAAGG + Intronic
1054840118 9:69729459-69729481 CTGTAGCCCTTCAATAATGAGGG - Intronic
1057190860 9:93086869-93086891 CTGGAGCCCAGCAGCCATGTTGG + Intergenic
1057214667 9:93221089-93221111 CCGGAGCCCTGCGGTGGGGAGGG + Intronic
1058983128 9:110188457-110188479 CTGGACGTCTGCAGTGAGGAAGG - Intergenic
1060594792 9:124841462-124841484 CTGGGGCCCTGCAGAGGTCAGGG + Intergenic
1061022201 9:128023162-128023184 ATGGAGCCGTGCAGTGATCCTGG - Intergenic
1062136646 9:134932339-134932361 GTGGAGCTCAGCAGTGATGGAGG - Intergenic
1062476969 9:136733060-136733082 GTGGAGCCCTGCAGGGCTGCTGG + Intergenic
1062519246 9:136950831-136950853 CTGGAGCCCTGAAGTCCTGGGGG + Intronic
1187433577 X:19246943-19246965 CTGTAGCCCTGGAGTGAAGAGGG - Intergenic
1192679568 X:73237892-73237914 CAGGAGTCCTCCAGGGATGATGG - Intergenic
1200399163 X:156008681-156008703 AGGGAGCACTGCAGTGATGGAGG + Intronic