ID: 1123937984

View in Genome Browser
Species Human (GRCh38)
Location 15:25203180-25203202
Sequence TTCGGATACTGCTGGATGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123937979_1123937984 1 Left 1123937979 15:25203156-25203178 CCTGCACTGAGCTTGGTGAGCCC No data
Right 1123937984 15:25203180-25203202 TTCGGATACTGCTGGATGCATGG No data
1123937974_1123937984 21 Left 1123937974 15:25203136-25203158 CCTTCCTTGTGCCCTAGTCTCCT No data
Right 1123937984 15:25203180-25203202 TTCGGATACTGCTGGATGCATGG No data
1123937975_1123937984 17 Left 1123937975 15:25203140-25203162 CCTTGTGCCCTAGTCTCCTGCAC No data
Right 1123937984 15:25203180-25203202 TTCGGATACTGCTGGATGCATGG No data
1123937977_1123937984 9 Left 1123937977 15:25203148-25203170 CCTAGTCTCCTGCACTGAGCTTG No data
Right 1123937984 15:25203180-25203202 TTCGGATACTGCTGGATGCATGG No data
1123937973_1123937984 22 Left 1123937973 15:25203135-25203157 CCCTTCCTTGTGCCCTAGTCTCC No data
Right 1123937984 15:25203180-25203202 TTCGGATACTGCTGGATGCATGG No data
1123937976_1123937984 10 Left 1123937976 15:25203147-25203169 CCCTAGTCTCCTGCACTGAGCTT No data
Right 1123937984 15:25203180-25203202 TTCGGATACTGCTGGATGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123937984 Original CRISPR TTCGGATACTGCTGGATGCA TGG Intergenic
No off target data available for this crispr