ID: 1123938806

View in Genome Browser
Species Human (GRCh38)
Location 15:25206869-25206891
Sequence CGATGCACCAAGTCTCAGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123938806_1123938820 29 Left 1123938806 15:25206869-25206891 CCCATCTGAGACTTGGTGCATCG No data
Right 1123938820 15:25206921-25206943 TGAGGTGGCCACAGGGGCTCCGG No data
1123938806_1123938819 23 Left 1123938806 15:25206869-25206891 CCCATCTGAGACTTGGTGCATCG No data
Right 1123938819 15:25206915-25206937 GACACATGAGGTGGCCACAGGGG No data
1123938806_1123938818 22 Left 1123938806 15:25206869-25206891 CCCATCTGAGACTTGGTGCATCG No data
Right 1123938818 15:25206914-25206936 GGACACATGAGGTGGCCACAGGG No data
1123938806_1123938817 21 Left 1123938806 15:25206869-25206891 CCCATCTGAGACTTGGTGCATCG No data
Right 1123938817 15:25206913-25206935 AGGACACATGAGGTGGCCACAGG No data
1123938806_1123938813 11 Left 1123938806 15:25206869-25206891 CCCATCTGAGACTTGGTGCATCG No data
Right 1123938813 15:25206903-25206925 AGGACTGCCCAGGACACATGAGG No data
1123938806_1123938814 14 Left 1123938806 15:25206869-25206891 CCCATCTGAGACTTGGTGCATCG No data
Right 1123938814 15:25206906-25206928 ACTGCCCAGGACACATGAGGTGG No data
1123938806_1123938810 -9 Left 1123938806 15:25206869-25206891 CCCATCTGAGACTTGGTGCATCG No data
Right 1123938810 15:25206883-25206905 GGTGCATCGGTCAGGCCTTGAGG No data
1123938806_1123938821 30 Left 1123938806 15:25206869-25206891 CCCATCTGAGACTTGGTGCATCG No data
Right 1123938821 15:25206922-25206944 GAGGTGGCCACAGGGGCTCCGGG No data
1123938806_1123938811 1 Left 1123938806 15:25206869-25206891 CCCATCTGAGACTTGGTGCATCG No data
Right 1123938811 15:25206893-25206915 TCAGGCCTTGAGGACTGCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123938806 Original CRISPR CGATGCACCAAGTCTCAGAT GGG (reversed) Intergenic
No off target data available for this crispr