ID: 1123945261

View in Genome Browser
Species Human (GRCh38)
Location 15:25235845-25235867
Sequence CCACCCTCCATGGGGAGAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123945261_1123945270 17 Left 1123945261 15:25235845-25235867 CCCATTCTCCCCATGGAGGGTGG No data
Right 1123945270 15:25235885-25235907 GTGTCCCTAGATGGTGAGACTGG No data
1123945261_1123945271 20 Left 1123945261 15:25235845-25235867 CCCATTCTCCCCATGGAGGGTGG No data
Right 1123945271 15:25235888-25235910 TCCCTAGATGGTGAGACTGGAGG No data
1123945261_1123945267 8 Left 1123945261 15:25235845-25235867 CCCATTCTCCCCATGGAGGGTGG No data
Right 1123945267 15:25235876-25235898 ACTCCACCTGTGTCCCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123945261 Original CRISPR CCACCCTCCATGGGGAGAAT GGG (reversed) Intergenic
No off target data available for this crispr