ID: 1123948915

View in Genome Browser
Species Human (GRCh38)
Location 15:25252110-25252132
Sequence CCTCTATGGACCCACGTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123948915_1123948922 22 Left 1123948915 15:25252110-25252132 CCCATTACGTGGGTCCATAGAGG No data
Right 1123948922 15:25252155-25252177 CCCCTTCCCACTTCTTCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123948915 Original CRISPR CCTCTATGGACCCACGTAAT GGG (reversed) Intergenic
No off target data available for this crispr