ID: 1123958009

View in Genome Browser
Species Human (GRCh38)
Location 15:25360481-25360503
Sequence AACTGCTTCTTCAAGTCTGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 217
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 197}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123958003_1123958009 19 Left 1123958003 15:25360439-25360461 CCTCCCTCATCAACTCCTTGTTC 0: 1
1: 0
2: 3
3: 25
4: 298
Right 1123958009 15:25360481-25360503 AACTGCTTCTTCAAGTCTGCAGG 0: 1
1: 1
2: 1
3: 17
4: 197
1123958005_1123958009 15 Left 1123958005 15:25360443-25360465 CCTCATCAACTCCTTGTTCTCCT 0: 1
1: 0
2: 4
3: 35
4: 439
Right 1123958009 15:25360481-25360503 AACTGCTTCTTCAAGTCTGCAGG 0: 1
1: 1
2: 1
3: 17
4: 197
1123958007_1123958009 -5 Left 1123958007 15:25360463-25360485 CCTTCAAATTCCACATACAACTG 0: 1
1: 1
2: 2
3: 20
4: 203
Right 1123958009 15:25360481-25360503 AACTGCTTCTTCAAGTCTGCAGG 0: 1
1: 1
2: 1
3: 17
4: 197
1123958006_1123958009 4 Left 1123958006 15:25360454-25360476 CCTTGTTCTCCTTCAAATTCCAC 0: 2
1: 0
2: 2
3: 28
4: 372
Right 1123958009 15:25360481-25360503 AACTGCTTCTTCAAGTCTGCAGG 0: 1
1: 1
2: 1
3: 17
4: 197
1123958004_1123958009 16 Left 1123958004 15:25360442-25360464 CCCTCATCAACTCCTTGTTCTCC 0: 1
1: 0
2: 4
3: 44
4: 385
Right 1123958009 15:25360481-25360503 AACTGCTTCTTCAAGTCTGCAGG 0: 1
1: 1
2: 1
3: 17
4: 197

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123958009 Original CRISPR AACTGCTTCTTCAAGTCTGC AGG Exonic
905272572 1:36796500-36796522 GGCTGCTTCTTCATGTCTGGAGG + Exonic
905500547 1:38433118-38433140 ACCTTCTTCTTCATGTCTCCTGG - Intergenic
905678038 1:39843701-39843723 TTCTGCTTCTTCCAGTCTCCTGG + Intronic
907307845 1:53523412-53523434 AGCTGCTTCCTCCAGCCTGCAGG + Intronic
907508578 1:54941274-54941296 ATCAGCTTCTTGAACTCTGCTGG + Intergenic
907853450 1:58278799-58278821 ATCTCCTTCATCAAGTCAGCAGG + Intronic
908848963 1:68354672-68354694 AACTGCTACTTCAAGACTAAGGG - Intergenic
909271754 1:73630537-73630559 TTCTGCTTCATCAATTCTGCTGG - Intergenic
909590945 1:77348700-77348722 AACTGCTGTTTCAACCCTGCAGG + Intronic
910814073 1:91271037-91271059 AACTGCTTCTACAATTCTACTGG + Intronic
911581096 1:99634284-99634306 AACTGCTACTTCAATCATGCTGG + Intergenic
911993466 1:104732980-104733002 AAATGCCGCTACAAGTCTGCCGG + Intergenic
912420208 1:109537575-109537597 AACTGCTTATTCTAGCCTGTGGG - Intergenic
912919750 1:113854617-113854639 ATCTTCTTCCTCAAATCTGCTGG - Intronic
915237880 1:154498979-154499001 TTCTGTTTCTTCAAGTCAGCAGG + Intronic
916830486 1:168485723-168485745 CCCTTCTTCTTCAGGTCTGCTGG - Intergenic
916845956 1:168650228-168650250 AACTGCCTCTTCTACTCTGTAGG - Intergenic
917636906 1:176945884-176945906 AACTGATTGTTCAAGACTGTTGG - Intronic
919082963 1:192888580-192888602 AAATTCTTCTTTAAGTCTCCAGG + Intergenic
919647643 1:200111527-200111549 TTCTGCTGCTTCCAGTCTGCTGG + Intronic
920825190 1:209418362-209418384 CACTCCATCTTCAACTCTGCTGG + Intergenic
921898711 1:220427937-220427959 AAATTCTTCTTCAGGTATGCTGG + Intergenic
923285799 1:232493790-232493812 ATCTGTTTCATCAAGTCTTCTGG + Intronic
924931589 1:248737230-248737252 AACTGGTTCTTAAAATCTTCTGG - Intronic
1063635460 10:7778089-7778111 CACTGATTCTTCAAGACTCCTGG + Intronic
1064398453 10:15000649-15000671 AATTGCTTCCTCAAATCTGTGGG + Intergenic
1065365787 10:24935750-24935772 GTTTGCTTCTTCAAGTCTGACGG - Intronic
1068196705 10:53726850-53726872 ATCTGCTTCTTCCAGTACGCTGG - Intergenic
1068537284 10:58254634-58254656 AACTGTCTCTTCAAATGTGCAGG - Intronic
1068941921 10:62689015-62689037 ATTTGCTTCTTCAAGCCTGGCGG - Intergenic
1069756809 10:70778618-70778640 AACTCCTTCTTCCAGGCTTCTGG + Exonic
1073268768 10:102244327-102244349 AGCAGCTTCTCCAGGTCTGCAGG + Intergenic
1075337636 10:121619861-121619883 AACTCCTGCTTCAAGTCTCCTGG + Intergenic
1075419965 10:122293472-122293494 GAGTGCTTCTTCAAGACTCCAGG - Intronic
1075733293 10:124648977-124648999 AGCTGCTTCTGCAAGTCAGTAGG - Intronic
1082824250 11:57566734-57566756 AAGTGCCCCTTCCAGTCTGCAGG - Intronic
1085921628 11:80964389-80964411 GACTGTTTCTTCAATTCTGGGGG + Intergenic
1086597053 11:88585213-88585235 AACTGCTTCTTCAGGTCCTTAGG + Intronic
1088618245 11:111655529-111655551 AACTGCTGCTTAAAATCTGTGGG + Intronic
1091537442 12:1425371-1425393 AAGAGCTTCTACAAGTCTGTGGG - Intronic
1093163771 12:15781598-15781620 ACCTGCTTCTTGAAGACTACTGG + Intronic
1098066824 12:66627653-66627675 AACCCCTTCTTCAAATCTGCAGG - Intronic
1103983802 12:124754053-124754075 GACAGCTTCTTCACCTCTGCAGG + Intergenic
1104530869 12:129569986-129570008 AGCTGTTTCTTCAATTCTACGGG + Intronic
1104621021 12:130312937-130312959 CATTGCTTCTTCAGGTCTGTGGG + Intergenic
1107179633 13:37443890-37443912 AAATGCTTCCTCAAGTCTCCAGG + Intergenic
1108297315 13:49037452-49037474 AACTGCTCCTTTACGTTTGCTGG - Intronic
1109420003 13:62099787-62099809 AGCTGCTTCTTCCTCTCTGCTGG - Intergenic
1110139688 13:72113384-72113406 AATTGCTTCTTCAAGTTTAGTGG - Intergenic
1110339372 13:74370999-74371021 ATCTGCTTCTTTTAGTCTGCTGG + Intergenic
1110785871 13:79525004-79525026 ATCAGCTTCTTCAACTCTGCCGG + Intronic
1112422274 13:99263341-99263363 AAGTGCTTGTTCAAGTCTTTTGG - Intronic
1113204325 13:107897942-107897964 ATCTGCTTCTCCTGGTCTGCAGG - Intergenic
1113836704 13:113332792-113332814 GACGGCTTCCTCGAGTCTGCAGG - Intronic
1117223302 14:53629543-53629565 AACTGCTGCTTCAAATCAGGTGG - Intergenic
1117550947 14:56835400-56835422 AACTCCCTCTTCAGGTCAGCAGG - Intergenic
1118603785 14:67488506-67488528 ACCGGCTTCTTCCAGCCTGCCGG + Intronic
1119024607 14:71142645-71142667 TACTGCCTCTTCAGGTCTGCAGG + Intergenic
1119138795 14:72245746-72245768 AACTGCTTCTTCAAGTCTGTTGG - Intronic
1120678499 14:87451116-87451138 ATCTTCCTCTTCAAGTCTTCTGG + Intergenic
1122459031 14:101879957-101879979 ATCTGCTTGTTCACGTCTGTGGG + Intronic
1122476067 14:102009950-102009972 AACAGCTTCTTCAAGTTGTCAGG - Exonic
1123958009 15:25360481-25360503 AACTGCTTCTTCAAGTCTGCAGG + Exonic
1124393827 15:29283188-29283210 AACTTCTCTTTCAAGTGTGCAGG - Intronic
1125779236 15:42249541-42249563 AACTGCTTCTGAATGACTGCTGG - Intronic
1125811740 15:42548219-42548241 GTCAGCTTCTGCAAGTCTGCGGG + Exonic
1125835258 15:42744867-42744889 GACTGCTTCCTTAAGTCTTCTGG - Exonic
1126349628 15:47730868-47730890 TCCTGCTTCTTCACGACTGCAGG + Intronic
1126414154 15:48400588-48400610 AACTGCTTCTTCAATAGTGGAGG - Intergenic
1127411398 15:58710833-58710855 CTCTGCTTCTCAAAGTCTGCTGG + Intronic
1127964027 15:63910496-63910518 AACTGCATTTTAAAGTCTACAGG + Intronic
1129689080 15:77703144-77703166 TACTCCTTCTTCATGTCAGCAGG + Intronic
1132811722 16:1802523-1802545 AGCTGCTTCTGAAAGTCTGATGG + Intronic
1133866354 16:9647619-9647641 TCCTGCCTCTTCATGTCTGCTGG + Intergenic
1137872598 16:51964796-51964818 AACTGCTTCTCCATGGCTGATGG - Intergenic
1140274736 16:73498511-73498533 AATTCCTTCTTCAACTCTTCAGG - Intergenic
1143235036 17:5392417-5392439 AACTGCTGTTTAAAGACTGCTGG - Intronic
1145788662 17:27610536-27610558 AACTGCTCCTCCCAGTCTGGGGG + Intronic
1146618690 17:34378327-34378349 AAGAGCTCCTTCAAATCTGCAGG - Intergenic
1147792200 17:43021037-43021059 AACTGGTTGGCCAAGTCTGCAGG - Intronic
1149689442 17:58562173-58562195 CACTGCTTCCCCAAGTCTGATGG + Intronic
1150807196 17:68328836-68328858 ACCTGTTTCTTCCAGTCTGGTGG - Intronic
1153684223 18:7529134-7529156 AGCTGCTTCTCCATGACTGCAGG - Intergenic
1154291389 18:13110934-13110956 ACCTGCCTCTTCTAGCCTGCTGG + Intronic
1156226689 18:35116679-35116701 AACTGCTTCTTCAGGGCAGTAGG + Intronic
1157603585 18:48911331-48911353 AACTACTCTTTCAAGGCTGCTGG + Intergenic
1158001085 18:52620001-52620023 AATGGCTTCTTCAAGTCTAGTGG - Intronic
1160166902 18:76521785-76521807 AACTGCTTCTAAATGTCTCCCGG + Intergenic
1162289459 19:9768189-9768211 AAATGCTTTGTCAAGTGTGCAGG - Intronic
1162707045 19:12562971-12562993 AACTGGGTCTTCAAGACTTCAGG + Intronic
1162850208 19:13425340-13425362 AACTGCTGCTTCAAGTTTTATGG + Intronic
1162925118 19:13926971-13926993 AACTGCTCCTTGAACTCTGCAGG - Exonic
1164736997 19:30548941-30548963 AACTGCTTGTAGAAGTCTGATGG - Exonic
1167422616 19:49413130-49413152 CACTCCTTCTTCATGTCTTCCGG + Intronic
1168120152 19:54247512-54247534 ACCTGCTTCTTCCAGGCTGGGGG - Intronic
925279494 2:2672806-2672828 AGTTGCTTCCTCAAGTCTACCGG + Intergenic
925371305 2:3347624-3347646 AACTGATTCTTCAAGAGTGAGGG + Intronic
925410410 2:3636699-3636721 AACTGCTCCTACCTGTCTGCTGG - Intronic
925786789 2:7439137-7439159 ACCTTCTTCTTCATGTCAGCAGG + Intergenic
927562044 2:24080790-24080812 AACTGCTTCTACAGTTCAGCAGG - Intronic
927870437 2:26619684-26619706 TCCTGCTTCCTCAAATCTGCTGG - Intronic
930348220 2:50213800-50213822 AACTTCTTGTTCAACTCTGAAGG + Intronic
931211993 2:60206584-60206606 ACCTTCTTCTGCAGGTCTGCTGG + Intergenic
934949654 2:98567558-98567580 AACTGCTCCTGCAAGTCTGTGGG - Intronic
935628249 2:105189279-105189301 TCCTCCTTCTTCAGGTCTGCTGG - Intergenic
935942981 2:108260573-108260595 AAGTGGTTCTTCCAGTCTCCAGG - Intronic
935989575 2:108706657-108706679 TAGTACCTCTTCAAGTCTGCAGG + Intergenic
936400848 2:112163348-112163370 AACTGTTGCTTCAACTGTGCAGG - Intronic
936750528 2:115635572-115635594 AAATAATTCTTCAAGTTTGCAGG + Intronic
938594444 2:132773129-132773151 AACCACTTCTTCAAGTGTCCAGG + Intronic
938648359 2:133353899-133353921 ACCTGCTTCTTCCAGGATGCTGG + Intronic
941185560 2:162318171-162318193 ATCTGCTCCTTCACCTCTGCAGG + Exonic
943398118 2:187367895-187367917 AACTGCCTCTGTAACTCTGCTGG - Intronic
945794627 2:214347073-214347095 AATAGCATCTTCAAGGCTGCTGG - Intronic
947520952 2:230845648-230845670 AACTGCTACTTAATGTCTCCTGG + Intergenic
1169789159 20:9391610-9391632 AACTGCTTCTGCAAGTTCGAGGG - Intronic
1173313755 20:41924974-41924996 AACCACTTCTTCCAGTCTGATGG + Intergenic
1173843850 20:46175791-46175813 AGCTGCCTCTTCAGGTCTGCAGG - Intronic
1174426539 20:50435626-50435648 AACTGCTCTTGCGAGTCTGCAGG - Intergenic
1177462859 21:21435575-21435597 ATCTTCTTCTTTAACTCTGCAGG + Intronic
1177631097 21:23728987-23729009 TACTGCTTCTGCAAGTGTGGTGG - Intergenic
1180748192 22:18106548-18106570 AACTACGTCTTCAGCTCTGCTGG - Intronic
1181009516 22:20032298-20032320 GACTGCTTCTGCAAGCCTGGTGG + Intronic
949365965 3:3280931-3280953 ACCTGCTACTTCTTGTCTGCTGG - Intergenic
950667208 3:14504953-14504975 AGCTGCTCCTACAAGTCTCCTGG - Intronic
952934185 3:38382728-38382750 AACTGCTTCTCCCTGTATGCTGG - Intronic
954682376 3:52352739-52352761 AGCTGCTTCCTCAAGCCTGGGGG - Intronic
956104177 3:65799511-65799533 AACAGCTTCTTCAACTCTGCTGG - Intronic
958906400 3:99946769-99946791 GACTGCTTCTTCCAGTATGTTGG + Intronic
960463713 3:117969317-117969339 AACTTGTTTTTCTAGTCTGCAGG - Intergenic
961678394 3:128582461-128582483 AACACCTTCTTGAAGTATGCTGG - Intergenic
962320380 3:134385149-134385171 CACTGCTTCTCCAAGGCTCCCGG + Intergenic
962368067 3:134798670-134798692 AACTGCCTCTTCAAGCCCACCGG + Intronic
962648422 3:137463603-137463625 AACTCTTTCTTCAAGGGTGCAGG - Intergenic
964819358 3:160754435-160754457 ATCTGCTGCTTCCAGTCCGCTGG - Intergenic
965025753 3:163299451-163299473 AATTGCTTCTGAATGTCTGCTGG + Intergenic
966576238 3:181505815-181505837 TCCTGCTTCTTCAAGACAGCAGG + Intergenic
967180112 3:186896142-186896164 AACTCCTTTTTAATGTCTGCTGG + Intergenic
967882665 3:194312979-194313001 AACTGCTTGTTCATTTCTGCTGG - Intergenic
967941496 3:194769780-194769802 AACTGCTCCTTCAAGTTACCTGG - Intergenic
968055526 3:195688748-195688770 ATCTGCTCCTGCCAGTCTGCAGG - Intergenic
968100267 3:195959849-195959871 ATCTGCTCCTGCCAGTCTGCAGG + Intergenic
968830126 4:2929036-2929058 ACCTGCCTCTTCAAGGCCGCTGG - Exonic
971265407 4:25092416-25092438 AACTGCTGCTGCAAGGCTGAAGG - Intergenic
973653756 4:53024181-53024203 AAGTGAATCTTCAAGTCTTCAGG - Intronic
975244946 4:72109555-72109577 ATCTGCTTCTTGAAGTGAGCAGG - Intronic
976698376 4:87942351-87942373 ACCTTCTTCTGCAGGTCTGCTGG - Intergenic
977367743 4:96093177-96093199 AACTGCTTCTGCACCTGTGCAGG - Intergenic
978021320 4:103816835-103816857 AACTGCTTCTTTGACTTTGCTGG - Intergenic
980156972 4:129118850-129118872 TTCTGCTTGTTCTAGTCTGCTGG - Intergenic
980570329 4:134608065-134608087 ACTTTCTTCTTCAGGTCTGCTGG - Intergenic
982935997 4:161476151-161476173 TTCTCCTTCTTCAAGTTTGCTGG + Intronic
983813133 4:172089269-172089291 AACTAGTTTTTCAAGTCTGGAGG + Intronic
985193721 4:187405678-187405700 AACTGCTCCTGAAAGACTGCTGG - Intergenic
985503440 5:263528-263550 ATCTGCTCCTGCCAGTCTGCAGG - Intergenic
985734254 5:1568757-1568779 ATCTGCTCCTGCCAGTCTGCAGG + Intergenic
986395334 5:7323541-7323563 AACTGCATCCTCAGGGCTGCAGG - Intergenic
987724258 5:21677317-21677339 AAATGCTTCTTCATTTCTGAAGG + Intergenic
990230937 5:53712421-53712443 AACTGCTTCCTCAAGTGGGTGGG - Intergenic
990469340 5:56099460-56099482 AACTGCCTATTCAACTCTGTTGG + Intergenic
996945456 5:129061653-129061675 CACAGTTTCTTCAACTCTGCTGG + Intergenic
997522179 5:134530003-134530025 ACCTGCTTCTCCAAGTCTAGAGG - Intronic
997575028 5:134968272-134968294 AACTGGTCATTCAAGTCTACAGG - Exonic
997803244 5:136888226-136888248 AACTGCATCTTTGAGTCTGCAGG + Intergenic
998026676 5:138822662-138822684 AACTGATTCTTTAAATCTACAGG + Intronic
998438239 5:142132569-142132591 CACTACTTTTTCAAGTCTCCTGG + Intronic
998605529 5:143630594-143630616 ATTTGCTTCCTCAAGTCTCCTGG + Intergenic
998951522 5:147397343-147397365 AAATGACTCTTCAAGTCTGAAGG - Intronic
999096791 5:148986186-148986208 CACAGCTTCTTCATCTCTGCAGG + Intronic
1000798275 5:165692666-165692688 ACCCGCTTCTCCAGGTCTGCTGG + Intergenic
1001459593 5:171898762-171898784 AAATGCTTCTGCAAGGCTGCCGG - Intronic
1003049919 6:2770540-2770562 AAATGCATCTTCAAGTGTGCAGG - Intronic
1007966677 6:46009793-46009815 AACTGCTTCCCCAAGGCTCCTGG - Intronic
1010414251 6:75595898-75595920 AACTGCTTCATTACTTCTGCAGG - Intergenic
1010774452 6:79869328-79869350 AACAGCCTCTTCCAGTCTACGGG + Intergenic
1013076174 6:106773623-106773645 GTCTGCTTCTTCAAGAGTGCAGG - Intergenic
1013494925 6:110688958-110688980 AACTGCCCCTCCCAGTCTGCTGG - Intronic
1015718531 6:136216408-136216430 AAATGCTCCTTCCAGTCTGCCGG - Intergenic
1015811076 6:137162871-137162893 AATTCCTTCTTCAGGTCTACAGG - Intronic
1018535957 6:164819021-164819043 AAGTACCTCTACAAGTCTGCTGG + Intergenic
1018869134 6:167768224-167768246 AACTGCTCCTTCAGGTATACAGG - Intergenic
1019603757 7:1898375-1898397 ACCTGCTTCTTCAGCTCTGCGGG + Exonic
1019953614 7:4393520-4393542 AACTGCATCTGCATTTCTGCTGG - Intergenic
1021190365 7:17613282-17613304 GCCTGCTTCTTCAAATGTGCAGG - Intergenic
1021365522 7:19773239-19773261 AAGTGCTTCTGCAAGTCTCTGGG + Exonic
1022968136 7:35493237-35493259 AAGGGCTTCTTCAATTCTCCAGG - Intergenic
1024488405 7:49947449-49947471 CAGTGCATCTGCAAGTCTGCAGG - Intronic
1026388716 7:69878215-69878237 AAGTGAGTCTTGAAGTCTGCTGG + Intronic
1026479297 7:70764521-70764543 AACTGCTGCTTCAGGGCTGTGGG - Intronic
1027400753 7:77803820-77803842 AAATGATTATTCAACTCTGCCGG - Intronic
1027444005 7:78251495-78251517 AACTGACTCTTTAAGTCTGGAGG - Intronic
1031773549 7:125877415-125877437 ATTTACTTCTTCAGGTCTGCAGG - Intergenic
1033532325 7:142277244-142277266 AACAGCTTCATCAAAACTGCAGG + Intergenic
1037207349 8:16339088-16339110 AACTGCATTTTCCAGTTTGCAGG - Intronic
1038577372 8:28716816-28716838 AACTGCTTCTCCAGCTCAGCAGG - Exonic
1039845610 8:41323522-41323544 AGCTGCTCCTTCCAGCCTGCAGG + Intergenic
1040598409 8:48861814-48861836 AACAGTTTCTTCAAGTCACCAGG - Intergenic
1041561689 8:59225929-59225951 GACTGCTTCTTCAAGCAAGCAGG + Intergenic
1042156088 8:65845479-65845501 TTCTGCCTATTCAAGTCTGCTGG + Intergenic
1043227201 8:77747321-77747343 ACCTGCTTGATCAATTCTGCTGG - Intergenic
1043532542 8:81166547-81166569 ACCCTCTTCTGCAAGTCTGCTGG - Intergenic
1044603885 8:94032465-94032487 AAGTGCTTCTTGAATTCTTCTGG - Intergenic
1045150585 8:99402671-99402693 AATAGCATCTTCAAATCTGCTGG + Intronic
1046533969 8:115484848-115484870 AACTGATTCTCCAAGACTGGTGG - Intronic
1046711030 8:117511871-117511893 AACTGCTTCTTCTAGTAGGCTGG - Intergenic
1051160685 9:14204293-14204315 TCCTGCTTCTTCAAGACAGCAGG - Intronic
1051433113 9:17000961-17000983 AACAGATTCTTCAAGTGTGTTGG - Intergenic
1053346758 9:37383751-37383773 AACATCTTGTTCAAGGCTGCTGG + Intergenic
1054885757 9:70196637-70196659 AATTATTTCTTCAACTCTGCTGG - Intronic
1056276975 9:85002961-85002983 AACTGTTTCTCCAACTCAGCAGG - Intronic
1060263760 9:122097353-122097375 ATCTGCTTCTTCAAGAGGGCAGG + Intergenic
1060460087 9:123844355-123844377 AACTAGTTCATCAAATCTGCAGG + Intronic
1061597986 9:131644978-131645000 AATTGTGTCTTCTAGTCTGCAGG - Intronic
1186331196 X:8536020-8536042 AAATGCTTCTTCCAGTCTTTTGG + Intronic
1186774259 X:12848243-12848265 AACTTTTTCTTCAATTTTGCTGG - Intergenic
1187997447 X:24943472-24943494 AACTAATTCTTCAAGTTTACTGG + Intronic
1193617824 X:83711858-83711880 GACTGCTTCTTTAAGTGTGAAGG - Intergenic