ID: 1123960575

View in Genome Browser
Species Human (GRCh38)
Location 15:25395413-25395435
Sequence CAGAGTAAACAGAAGTATAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 0, 2: 3, 3: 43, 4: 353}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123960573_1123960575 -2 Left 1123960573 15:25395392-25395414 CCAAAAGATGATGCCTTTAAACA 0: 1
1: 0
2: 4
3: 25
4: 323
Right 1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG 0: 1
1: 0
2: 3
3: 43
4: 353
1123960572_1123960575 23 Left 1123960572 15:25395367-25395389 CCTGGGAAACAATTTCTTTCTTT 0: 1
1: 0
2: 8
3: 99
4: 911
Right 1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG 0: 1
1: 0
2: 3
3: 43
4: 353

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123960575 Original CRISPR CAGAGTAAACAGAAGTATAA TGG Intronic
902366640 1:15979392-15979414 CAAAGCAAACAAAAATATAAAGG - Intergenic
903730147 1:25487645-25487667 TGGAGTAAACAGAAAAATAAGGG - Intronic
903912996 1:26742226-26742248 CTGGGAAAACAGAAGTAAAATGG - Intronic
904637901 1:31898623-31898645 CAAAGGAAACAGAAGTAACATGG + Intergenic
905911599 1:41658736-41658758 CAGAGTGAACAGGATAATAAGGG + Intronic
906767852 1:48451889-48451911 CAGAGGAAAAACAAATATAAAGG - Intronic
907352623 1:53845336-53845358 CAGATTAAGCAGAGGTATGAAGG - Intergenic
909516855 1:76520038-76520060 TAGAGGAAACAGAAATAAAATGG - Intronic
910269601 1:85379632-85379654 AACAGTGAACAGTAGTATAATGG - Intronic
910607124 1:89099399-89099421 CAGGGAAATCAGAAATATAAGGG - Intergenic
910776777 1:90884772-90884794 AAGAGTAATCTGATGTATAAAGG - Intergenic
910899498 1:92104757-92104779 CACAGAAAACAGAAGTTTCAAGG - Intronic
913707957 1:121446939-121446961 CAGAGTAAGTATAAGTATATTGG + Intergenic
915217028 1:154347259-154347281 AAGAGGAAACAGCAATATAAAGG + Intronic
915372160 1:155360417-155360439 GAGAGAAAACAGAGTTATAAAGG + Intronic
915537984 1:156549022-156549044 CAGCTTGAACAGAAGCATAAAGG + Intronic
915687886 1:157653593-157653615 CAGAGGAAACTGAAGCATCAAGG + Intergenic
916253948 1:162767084-162767106 AAGAATAAGCAGAAGTATTAAGG + Intronic
916275941 1:162993282-162993304 ATTAGTAAACATAAGTATAAAGG + Intergenic
916295156 1:163211033-163211055 AAGAGTAAACAGGAGTGAAATGG + Intronic
916551577 1:165854845-165854867 CAGGAAAAACAGAAGTATAAAGG - Intronic
916763197 1:167835280-167835302 CAGAGGACACAGAAGGGTAAAGG - Intronic
917704491 1:177618303-177618325 CAGAGGAAACAGAAAGATCAAGG + Intergenic
918933124 1:190883083-190883105 AAGAGTCAACAGAAATCTAAAGG + Intergenic
919258107 1:195152687-195152709 CAGAGCAAACACAAGTATCCAGG + Intergenic
919446868 1:197716941-197716963 CAGAGTATACAGAAAAAAAATGG - Intronic
920278983 1:204829114-204829136 CGAGGTAAACAGAAGTACAAGGG - Intronic
920784757 1:209030487-209030509 CAGATTAAACAAAAAAATAAAGG - Intergenic
921761138 1:218916551-218916573 CAGAGTCACCAGAAGTTTAAGGG + Intergenic
922217145 1:223529192-223529214 GAGAGAAAAAAGAGGTATAAAGG + Intergenic
922917972 1:229273943-229273965 CAGAGTACAAAGGAGTTTAAAGG - Intronic
922933062 1:229404915-229404937 CTGGATAAACAGAAGTATTATGG + Intergenic
923876562 1:238055683-238055705 CAGAGTAACCAGAATTCTGAAGG - Intergenic
923878604 1:238077746-238077768 CAAAATAAAAAGAAGTAAAAGGG - Intergenic
1063195688 10:3740629-3740651 CTGAGAAAACAGAGGTATTAAGG - Intergenic
1063566602 10:7176864-7176886 CAGTGTAAACAGAATCGTAAGGG + Intronic
1063860483 10:10302053-10302075 CAGAGCAAAGAGAAGTATACAGG - Intergenic
1064620891 10:17216288-17216310 AAAAGAAAACAGAAGCATAATGG + Intergenic
1065746203 10:28844857-28844879 CAGAGTAATTAGAAGTTAAAAGG + Intergenic
1066513182 10:36124449-36124471 CAAAGCAAACAGAGGCATAAAGG - Intergenic
1066816104 10:39415703-39415725 AAAAGTAGACAGAAGTATACTGG + Intergenic
1067422600 10:46168197-46168219 CAAATTAAACACAAGTAGAAGGG - Intergenic
1068593329 10:58873505-58873527 CTGAGTTAACAGAAGCATAAAGG + Intergenic
1069067414 10:63958100-63958122 GAGAGTAACAAGAAGTATGAGGG - Intergenic
1069339660 10:67395641-67395663 CAGAACTAACAGAAGCATAATGG + Intronic
1070268078 10:74924120-74924142 CAGAGGTAACAGAAGTAAAGGGG + Intronic
1070602151 10:77873481-77873503 CGGGGTAAACAGAATTATCAGGG - Intronic
1071411420 10:85400495-85400517 CAGAATAAACAGAAGGACCATGG + Intergenic
1072894327 10:99353245-99353267 CTGAGGAAACAGAAGTAAATAGG + Intronic
1073540623 10:104314235-104314257 CAGAGGAAACAGAATTTCAACGG - Exonic
1073715747 10:106105206-106105228 CAGTGAAACCTGAAGTATAATGG + Intergenic
1074296374 10:112193148-112193170 CAGAGAAGACAAAAGTAGAAGGG + Intronic
1076465169 10:130675530-130675552 CAAAGTAAACAGTAGTAGATGGG - Intergenic
1078905559 11:15684979-15685001 CAGAGTAAACTGGGGTAAAATGG - Intergenic
1079779758 11:24586310-24586332 AAAACTAAACAGAAGCATAATGG - Intronic
1080991910 11:37546572-37546594 CAGAAGAAAGAGAAGTTTAAAGG + Intergenic
1081011285 11:37815673-37815695 GAGACTAAACAGAAATATGAAGG - Intergenic
1081559794 11:44203290-44203312 CAGGGTAAAGAGAACTCTAAAGG + Intronic
1085595919 11:77809733-77809755 TTGATTAATCAGAAGTATAATGG - Intronic
1086731881 11:90260352-90260374 CAAAGTAAACAAGAGCATAAAGG - Intergenic
1086848245 11:91778378-91778400 CTGAGTGAACAAAAGTATTAAGG - Intergenic
1087897023 11:103597520-103597542 CAGAGTAGACAGAAGGAAACAGG - Intergenic
1088339547 11:108747617-108747639 CAGAGAAATCAGCAGTATACAGG - Intronic
1090487168 11:127123715-127123737 CAGATTAAACACAAGTATACAGG - Intergenic
1090725606 11:129524189-129524211 GAGAGAAAACAGAATTAGAATGG + Intergenic
1090876495 11:130793188-130793210 ATGATTAAACAGAAGTATACAGG - Intergenic
1092026415 12:5244634-5244656 CAGTGTAAACAGCAGAAGAAAGG - Intergenic
1094020692 12:25910837-25910859 AAGAGTCAACAGAAGAACAATGG - Intergenic
1094235115 12:28155406-28155428 CAAAGTAAGCAGGAGTCTAATGG - Intronic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097006826 12:55925827-55925849 AAGAGTAAAGAGAAGTATACTGG + Intronic
1097986794 12:65791668-65791690 CTGAGAAAAGAGAATTATAATGG - Intergenic
1098811599 12:75101267-75101289 CAGTGTGAAAAGAAGTTTAATGG - Intronic
1099704308 12:86130876-86130898 GAGAGTAAAAATAATTATAATGG - Intronic
1100216661 12:92457130-92457152 CAGAGGCAACACAAATATAATGG + Intergenic
1100244666 12:92745166-92745188 AAGCTTAAACAGAAGTAAAAGGG + Intronic
1100649616 12:96570738-96570760 CAGAGTAATCATAATAATAATGG - Intronic
1100939537 12:99710905-99710927 CAAAGCAAACTGAATTATAATGG - Intronic
1101044931 12:100794993-100795015 AAGAGTCAACAGAAGGAGAAGGG - Exonic
1101376275 12:104173910-104173932 CAGATCAAACAGGAGTTTAATGG - Intergenic
1104165943 12:126229956-126229978 CAGAGTAAACAGAAGTACAGGGG + Intergenic
1106206220 13:27597837-27597859 CAAAGAAAAGAGAATTATAAGGG + Intronic
1106545047 13:30723467-30723489 CAAAGCAAACAGAGGAATAAGGG + Intronic
1106646782 13:31643556-31643578 CAGAGAAAACAGAAGTATATAGG + Intergenic
1107275888 13:38678746-38678768 CAGAGCAAACAAAATTATGAGGG + Intergenic
1107702683 13:43063817-43063839 AAGAATAAACAAAATTATAAGGG + Intronic
1108941552 13:55962285-55962307 CAAAGTAAGCAGAAGTAAGAGGG + Intergenic
1109200057 13:59420379-59420401 CAGAGTTGACAGAGGTAGAAGGG + Intergenic
1109671471 13:65613887-65613909 AAAAGTAAAAAGAATTATAAAGG - Intergenic
1110219014 13:73053198-73053220 CAGAGTAAAAATAAGTGTAGAGG + Intergenic
1111734011 13:92114531-92114553 TAGAGTAATCAGAAGATTAAAGG + Intronic
1112061393 13:95742803-95742825 CACAGTCCACAGAAGTAAAAAGG - Intronic
1112607186 13:100918203-100918225 CAGAGTAAACCCAAGCAGAAGGG + Intergenic
1113061476 13:106326699-106326721 CAGGGAAATCAGAAGTATAGAGG + Intergenic
1114377811 14:22168068-22168090 AAGAGAAAAAAGAAGTATCAAGG - Intergenic
1114756650 14:25267538-25267560 CAGAGAAAAAAAAAGTATTAAGG - Intergenic
1115637030 14:35299676-35299698 CAGGGTAAACAGTAGTATCATGG - Intronic
1116694854 14:48160240-48160262 ATGAGTAAAAAGGAGTATAAAGG + Intergenic
1116797967 14:49412016-49412038 CAGAGAAAACAGACGTTTATTGG + Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117126661 14:52635281-52635303 CATAGTAAAATGAAGTAAAATGG + Exonic
1117426570 14:55604656-55604678 CTGAGTAAACAGCAGTAAAAGGG - Intronic
1117515090 14:56492813-56492835 GAGAATAAGCAGAAGTATGAAGG + Intronic
1119948776 14:78722954-78722976 CAGAAGGAACAGATGTATAAAGG + Intronic
1120124191 14:80720925-80720947 CAGAGAAAACCTAAGTATGAAGG + Intronic
1121596616 14:95168208-95168230 CAGAATAAACAGAGGGAGAAGGG - Intergenic
1122220360 14:100235048-100235070 GAGAGTAAGCAGAAGAATAAAGG - Intergenic
1122499989 14:102191083-102191105 CAGAGCACACAGAAGTATTTGGG - Intronic
1123960575 15:25395413-25395435 CAGAGTAAACAGAAGTATAATGG + Intronic
1125166834 15:36716085-36716107 CAAAGAAAACAGATCTATAAGGG + Intronic
1125279545 15:38029161-38029183 CAGAGTAAAAAGAGGCATATGGG + Intergenic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1126075782 15:44907832-44907854 CAAAGTAAACAGAAAAAAAAAGG + Intergenic
1126234877 15:46372224-46372246 CAGATTAAACTACAGTATAAAGG + Intergenic
1126577944 15:50215687-50215709 CAAAGTAAACAAAATCATAAAGG + Intronic
1127057791 15:55150294-55150316 CAGGGGAAACAGAAGTGTATAGG - Intergenic
1127392741 15:58520292-58520314 CAGAGGACACAGAAGTTAAAAGG - Intronic
1128659866 15:69490976-69490998 CGGAGAAAACAAAAGAATAAGGG + Intergenic
1129409352 15:75340249-75340271 AAAAATAAACAGAAGTATAAAGG + Exonic
1130221662 15:82024653-82024675 CAGAGAAAACCGAAGTTCAAAGG - Intergenic
1130230341 15:82092168-82092190 CAGAGGAAACTGAAGTGCAAAGG + Intergenic
1131570124 15:93526138-93526160 CAGAGTAAACAAAAATAGAAGGG - Intergenic
1132984778 16:2759611-2759633 CAGAGTCAGCAGAAGTTGAACGG - Exonic
1135391238 16:22095188-22095210 CAAAGGAAACTGAAATATAATGG + Intronic
1138838665 16:60470843-60470865 CATAGTAATCAGAAGCATATAGG + Intergenic
1138858377 16:60723655-60723677 AAGAGAAAGAAGAAGTATAAGGG + Intergenic
1139203301 16:65001436-65001458 CAGGGTAAATAGAAGAACAAAGG - Intronic
1139833616 16:69820684-69820706 CAAAATAAACAGTAGTATATGGG - Intronic
1140741071 16:77942125-77942147 CAAAGAAAAAAGAAGTTTAATGG + Intronic
1141208549 16:81955124-81955146 AAGAGTAAGCAGAGGTAAAATGG - Intronic
1141221622 16:82074680-82074702 CAGAGCACCCAGATGTATAAAGG + Intronic
1141844793 16:86600679-86600701 GATAGTAATCAGAAGGATAATGG - Intergenic
1143233752 17:5380113-5380135 CAGGGTAAACAGACATGTAAAGG - Intronic
1143829327 17:9638404-9638426 CGGAGTACACAGAAGTAGAGAGG + Intronic
1146061233 17:29608416-29608438 CAGAGTGAAGAGAATAATAATGG - Intronic
1147041262 17:37721197-37721219 CACAATAAACAGATTTATAATGG - Intronic
1147268776 17:39251876-39251898 CAGAATAAACAGATGTAAAGTGG + Intergenic
1148212479 17:45816909-45816931 CAGACTAACCTGAAGTTTAATGG - Intronic
1148548869 17:48537703-48537725 CAGATTAAACATAACTAAAAGGG + Intergenic
1150247157 17:63685143-63685165 GAGTGTAAACAGAAGCATTAAGG + Intronic
1150563213 17:66313070-66313092 CAGAGGAAACAGAAGTAGAGAGG - Intronic
1150670090 17:67187252-67187274 CAGAATAAAAACAAGTAAAAGGG + Intronic
1150911134 17:69388695-69388717 CATAGAAATCAGAAGTATAATGG - Intergenic
1203175624 17_KI270729v1_random:10895-10917 CTGAATCAACAGAAGTGTAATGG - Intergenic
1153143809 18:2005598-2005620 CAGAATAACTAGAATTATAAAGG + Intergenic
1155098605 18:22585538-22585560 CTGAAGAAACAGAAGTCTAAGGG + Intergenic
1158671196 18:59475509-59475531 CAGAATAAACAAAAGTATGGAGG - Intronic
1158891969 18:61880850-61880872 GTGAGTAAAGAGAAGAATAAGGG - Intronic
1159972846 18:74675166-74675188 CAGAGAAAGCATAAGTATAAAGG - Intronic
1164142180 19:22481531-22481553 CAAAGTCAACAGAAATAAAAAGG + Intronic
1164814021 19:31180385-31180407 CAGAGAAAACAGAAATGTCACGG - Intergenic
1165398048 19:35577963-35577985 CAGATTGAATATAAGTATAATGG + Intergenic
1167980599 19:53272099-53272121 CAAAGTGAGAAGAAGTATAAAGG - Intergenic
925139614 2:1540809-1540831 CGGAGTAAACAGAAATATGCAGG - Intronic
925913110 2:8586211-8586233 CTGAGGAAACAGAAGCATGACGG + Intergenic
926342974 2:11919964-11919986 CACAGCAAACAAAAATATAATGG - Intergenic
926665221 2:15514350-15514372 CTGAATAAATAGAAATATAAGGG + Intronic
926824084 2:16884827-16884849 GAGAGTAAAAGGAAGAATAAAGG - Intergenic
927291885 2:21412762-21412784 CAGAGTAAAGAAAAGTATCATGG + Intergenic
928963823 2:36957200-36957222 AAGACAAAACAGAAGTATATTGG + Intronic
930262528 2:49164387-49164409 CAGAGTAAGCAGAAATTGAAGGG + Intergenic
930385640 2:50691217-50691239 AAAAGTAAACAGAAAAATAAAGG + Intronic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
932291579 2:70584563-70584585 CAGAGAAAACAGAATTTTTAGGG - Intergenic
933484637 2:82903505-82903527 CAAAGTAAACACAAGTAAAACGG - Intergenic
933666447 2:84969035-84969057 AAGAGTAAGCAGAAATATTATGG - Intergenic
933987369 2:87603133-87603155 CAAAGTAAACAGAAATGTATTGG + Intergenic
936306470 2:111347675-111347697 CAAAGTAAACAGAAATGTATTGG - Intergenic
936990529 2:118360039-118360061 CAGAGTAAAAAGTATTATAAAGG - Intergenic
937608374 2:123828850-123828872 CAGATTCAACAGAAGTTTACTGG + Intergenic
938045278 2:128113581-128113603 AAGAGAAAACAGAAGAAAAAAGG - Intronic
938320987 2:130363545-130363567 CAAAGTAAGCAAATGTATAAAGG - Intronic
938996063 2:136679598-136679620 CAGAGTAAACAGAAGACTTTTGG + Intergenic
940031842 2:149271962-149271984 CAGAGGAAACAGCACCATAAAGG - Intergenic
940262504 2:151796313-151796335 GATAGTAAACAGAAGAAAAAAGG - Intronic
940506641 2:154563363-154563385 CAGAAAAAACAGATGTAAAAGGG - Intergenic
940698908 2:157017295-157017317 CAAAGTAAAAAAAAGTAAAATGG + Intergenic
940894211 2:159064759-159064781 CAGAGTAAGCAGAAGTTTTGTGG - Intronic
941153614 2:161947097-161947119 CTGAGGAAACTGAAGCATAAAGG - Intronic
941208296 2:162602551-162602573 CAGAGGAAACAGATGTGCAAAGG - Intronic
941293987 2:163713381-163713403 CTAAATAAACAGCAGTATAAAGG + Intronic
941852036 2:170193904-170193926 CAAATTAAACAGAAAAATAAGGG - Intronic
943164777 2:184307134-184307156 CAGAGTAAACAGACAAATTATGG - Intergenic
943654682 2:190495716-190495738 CAAAGCAAACAGAAACATAAAGG + Intronic
944184505 2:196931936-196931958 TAGAGTAAATAGAACTAGAAAGG + Intergenic
944345479 2:198660260-198660282 TAGAGGGAACATAAGTATAAGGG + Intergenic
944956493 2:204817454-204817476 CAGAGTACACAGAAGGGTATTGG - Intronic
945193535 2:207215678-207215700 CAAAGGAAAAAGAAGTGTAATGG + Intergenic
945483943 2:210371962-210371984 AAGAATAAAAAGAATTATAATGG - Intergenic
945492158 2:210468879-210468901 AAAAGAAAACAGAAGTATAGTGG - Intronic
947460921 2:230304632-230304654 CAAAGCAAACAAAAGCATAAAGG + Intronic
947843677 2:233226662-233226684 CAGAGTTAAGAGAAGTAGCAGGG + Intronic
1169564042 20:6833354-6833376 CAGAGTAAAAAGAACCATGAAGG + Intergenic
1169585836 20:7084300-7084322 CATACTAAAAAGAAGTATACAGG + Intergenic
1170160965 20:13310619-13310641 CAGAGTAAAGAGAAAAATTATGG + Intergenic
1170450832 20:16481837-16481859 CAGAGTAAACAAAATTAATAAGG + Intronic
1171748113 20:29019860-29019882 CAGAGTAAACAGAAAAACTATGG + Intergenic
1172820944 20:37733590-37733612 CAGAGGACACAGAAGTCCAAAGG - Intronic
1173078677 20:39845455-39845477 CAGAGGAAACAGATGTGCAAAGG + Intergenic
1173624888 20:44465576-44465598 CAGAACAAGCAGAAGAATAATGG - Intergenic
1173633679 20:44535995-44536017 CATAGAAAACAAAAGTAGAATGG - Intronic
1173646501 20:44636429-44636451 CAGAGTTTACCGAAGTATATGGG - Intronic
1174034467 20:47659856-47659878 CAGAGTAGACTGAATTATGAGGG + Intronic
1174695882 20:52557807-52557829 CAGATACAACAGAAATATAAAGG - Intergenic
1174881331 20:54282450-54282472 CAGAGTAAACAGAGGTAAAGAGG - Intergenic
1174887468 20:54351647-54351669 CAGAGGAAATTGAATTATAAAGG + Intergenic
1175669504 20:60889967-60889989 CAGAGCAAACAGAAGTGCAAAGG + Intergenic
1175888750 20:62306802-62306824 CAGAGCCAGCAGAAGTTTAAAGG - Intronic
1176891361 21:14323434-14323456 CAAAATAGAGAGAAGTATAATGG - Intergenic
1176893663 21:14350206-14350228 CAGAGTTATCAGGAGTAAAAAGG + Intergenic
1177240392 21:18448035-18448057 CATTATAAACAGTAGTATAAAGG + Intronic
1177438136 21:21082835-21082857 GAGAGGAAACAGAAGTACGAAGG - Intronic
1177503684 21:21993483-21993505 CAGAGAAAACAGAATTATACAGG - Intergenic
1177523267 21:22258897-22258919 CAGACTATACAAAAGTATAGAGG + Intergenic
1177735491 21:25083883-25083905 GAGAGCAAGAAGAAGTATAAGGG - Intergenic
1180254231 21:46612344-46612366 CAGAGCAAAGAAAATTATAATGG - Intergenic
950383593 3:12638037-12638059 CTGAGTAAAGAGAAGAATGATGG - Intronic
950456987 3:13098610-13098632 CAGAGGAAACAGCAGTGGAAAGG + Intergenic
953787284 3:45920713-45920735 CAGAGTAAACAGAGGCATGATGG - Exonic
955148014 3:56339338-56339360 CAGGGGAAAGAGAAGTGTAAGGG + Intronic
955150280 3:56360355-56360377 CAGAGTCTAGAGAAGTAGAAGGG - Intronic
957150272 3:76477552-76477574 CAGAGAAACTAGAGGTATAATGG - Intronic
957168589 3:76708334-76708356 CAGAGGGAACAGAAGCACAACGG + Intronic
959364665 3:105442204-105442226 GGGAGAAAAAAGAAGTATAAAGG - Intronic
959474511 3:106792258-106792280 CAGAGGAAACAAAAGAATAAAGG + Intergenic
960219683 3:115091153-115091175 CAGAGTAAATAGTATTATAATGG - Intronic
960303328 3:116031165-116031187 AATAGAAAATAGAAGTATAAAGG + Intronic
960396062 3:117138893-117138915 AAGAGTACTCAGAAGTAGAAAGG + Intronic
960453421 3:117839565-117839587 AAGAGTAGACAGAGATATAAAGG + Intergenic
963204610 3:142619865-142619887 CAGATTACTCAGAGGTATAATGG + Intronic
963586849 3:147202681-147202703 CAGCCTAAATATAAGTATAAAGG - Intergenic
964424370 3:156535670-156535692 CTGAGTAACTAGAAGTATATTGG - Intronic
964997005 3:162893830-162893852 CAGAGCACACAGAAATATAAAGG + Intergenic
965369639 3:167845271-167845293 AAGAGTAAACTGAAGTTTCAGGG + Intergenic
966011025 3:175077613-175077635 ATTATTAAACAGAAGTATAAAGG + Intronic
966308072 3:178559858-178559880 CAGACTATACAGATGTATTAAGG + Intronic
967647377 3:191942637-191942659 CCAAGTATACAGAAATATAAAGG + Intergenic
967672190 3:192250192-192250214 CAGAATAAACAGAAATAGAAAGG - Intronic
968385847 4:136631-136653 CACAGAAAACACAAGTAGAAAGG - Intronic
968407095 4:350310-350332 CATAGAAAGCAGAAGTAGAAAGG - Intronic
969202582 4:5617733-5617755 CAGAGAAAACAGAAGTTCGAAGG + Intronic
970103544 4:12554305-12554327 CACAGTAAAGAGCAGTAGAAAGG - Intergenic
971317249 4:25577774-25577796 CAGAGTTCACAGAATTGTAAGGG - Intergenic
971495607 4:27261232-27261254 CAGGGGAATCAGAAGAATAATGG + Intergenic
974920458 4:68232906-68232928 CAGAGTAAAGAGAATTATCATGG - Intronic
975018940 4:69463263-69463285 CAGAGTAAACATAAATATATTGG + Intergenic
976369961 4:84276371-84276393 GAGAGTAACTAGAAGTAGAAAGG - Intergenic
976964579 4:91020806-91020828 CAGAGAAAACAGAAGTACCTTGG - Intronic
977056042 4:92192009-92192031 CAGAAGGAACAGAAGTGTAAAGG - Intergenic
978223152 4:106302247-106302269 CAGAGTAAACAGCAATATAGTGG + Intronic
978303616 4:107297463-107297485 CAGAGCAAGCTGAAGTACAAAGG + Intergenic
981236343 4:142420099-142420121 CAAATTAAAAAAAAGTATAAAGG + Intronic
981565906 4:146101239-146101261 CAGAGTAAACAGATACAGAATGG - Intergenic
981889716 4:149720245-149720267 CAGAGTTAGCAGAAGAAAAATGG + Intergenic
982837871 4:160145518-160145540 GAGGGTAAGCAGAAGTCTAAAGG + Intergenic
982845970 4:160252942-160252964 AGGAGTAAACTGAAGTTTAAAGG - Intergenic
983467200 4:168109078-168109100 CAGTGAAAACTGAATTATAAAGG + Intronic
983717366 4:170799923-170799945 CACAGTAAAGGGAATTATAAAGG + Intergenic
983821777 4:172203124-172203146 CAGACTAAACAGCACTGTAAGGG + Intronic
984010498 4:174365596-174365618 GAGAGGAAACAGAAAAATAAAGG - Intergenic
984505306 4:180610134-180610156 CTGATCAAACAGAACTATAAAGG - Intergenic
984802470 4:183727733-183727755 CAGAGTACGCAGAAGTGTAGCGG + Intergenic
985014142 4:185615405-185615427 CAGATTAATAAGAAGTTTAAAGG + Intronic
985072238 4:186177904-186177926 GAGAGAAAACAAAATTATAATGG + Intergenic
986422873 5:7601696-7601718 CAGAGTGAAGAGAAGAATGAAGG - Intronic
986627875 5:9739529-9739551 CAGAGTAAACAGCAGTTTTTTGG - Intergenic
986961116 5:13214144-13214166 TAGATAAAACAGAAGGATAAGGG - Intergenic
987415641 5:17658875-17658897 CAAAGCAAACAAAAGCATAAAGG - Intergenic
987458775 5:18180748-18180770 CAGAGTAAACAGAGGTGGTAAGG - Intergenic
988213026 5:28231240-28231262 CAGAGCAAACAAAATTACAAGGG - Intergenic
989182758 5:38595168-38595190 CAGAGTGAAAAGAAATCTAAAGG + Intronic
989410484 5:41114153-41114175 CAGAGAAAACAGAAGTATACAGG - Intergenic
990642948 5:57808792-57808814 GAGACAAAACAGAAATATAAAGG - Intergenic
991058733 5:62348146-62348168 CAAAGTAAACAAAATTGTAAAGG + Exonic
992872220 5:81018571-81018593 CAGAGCAAACATTAGAATAAAGG + Intronic
993252261 5:85543715-85543737 CAGAGAAATCCTAAGTATAAAGG + Intergenic
994441987 5:99819206-99819228 CAGGGTTATCAGAAGTATTAAGG + Intergenic
994606691 5:101976267-101976289 CAAGGTAAAGAGAAGGATAATGG + Intergenic
995849110 5:116525828-116525850 GAAAGTAAATAGAAGTAAAACGG - Intronic
997983304 5:138484038-138484060 CATATTGAACAGAATTATAAGGG - Intergenic
998723163 5:144976784-144976806 CAGAGTAGACAGCAGCAGAATGG - Intergenic
999560373 5:152794937-152794959 CAGATTAAAGAGAGATATAAAGG + Intergenic
999581854 5:153047783-153047805 CACAGCACACTGAAGTATAATGG - Intergenic
1000729716 5:164818432-164818454 AATAGTAAACAAAAGTATATAGG - Intergenic
1000855574 5:166394089-166394111 GAGAATAAGCAAAAGTATAAAGG - Intergenic
1001227421 5:169957065-169957087 CAGAGTAAATGGAAGTCAAATGG - Intronic
1002003294 5:176211395-176211417 CAAAATAAAAAGAATTATAAGGG - Intergenic
1002223159 5:177699546-177699568 CAAAATAAAAAGAATTATAAGGG + Intergenic
1003006598 6:2388666-2388688 CAGAGTGAACTAAAGAATAATGG - Intergenic
1005214983 6:23515324-23515346 CAGAGGAAACAGCAGTAAGAGGG - Intergenic
1006244026 6:32714177-32714199 CAGAGAAAACAAAAAGATAATGG - Intergenic
1007930501 6:45686668-45686690 CAGAGTAGAGATGAGTATAATGG - Intergenic
1009160064 6:60270987-60271009 CACAGTAAATAGAAGGGTAATGG - Intergenic
1010479504 6:76333650-76333672 CAAAGCAAACAGAAACATAAAGG - Intergenic
1010947178 6:81989062-81989084 TCGAGTAAACAAAAGTATTAAGG + Intergenic
1011031470 6:82928642-82928664 CAGAGTAGAAAGAAGCACAAGGG + Intronic
1011757987 6:90525177-90525199 CAGAGAAAACAGAAAGTTAAAGG + Intronic
1012152980 6:95778819-95778841 CAAAGTAAACAAAAGGAAAATGG - Intergenic
1012613105 6:101240475-101240497 CAAATTAAAAAGAAGTATATGGG + Intergenic
1012746480 6:103096499-103096521 CAGAATAAACAGAAATACAGGGG - Intergenic
1013640894 6:112079384-112079406 AAGAGTCAACAGAACTATACTGG - Intronic
1014332254 6:120083988-120084010 CAGGGTAAATGGAAGTAAAATGG + Intergenic
1014498431 6:122156604-122156626 TAAAGTAAATAGAAATATAATGG + Intergenic
1016254459 6:142088064-142088086 TAGAGTAAACAGAGTTAAAACGG - Intronic
1018363630 6:163097178-163097200 CAGAGAAACCACAAATATAAGGG - Intronic
1020107082 7:5427112-5427134 CTGGGTAAACAAAAGTATGAGGG - Intergenic
1020746340 7:12083266-12083288 CAGAGGAAAAAGAATTACAAAGG + Intergenic
1021089566 7:16467106-16467128 GAAAGTAAAAATAAGTATAAAGG + Intronic
1021127729 7:16872639-16872661 CAAAGGAAACAAAAGCATAAGGG + Intronic
1021381502 7:19972745-19972767 AAGGGGAAAGAGAAGTATAATGG + Intergenic
1022045553 7:26619803-26619825 CAGAGTAAACTGAAGTGAAAAGG + Intergenic
1023445232 7:40224737-40224759 CACAGGAAACAGTAGTATAGCGG - Intronic
1023776800 7:43615775-43615797 CAGAGGGAAGAGAAGTATAGAGG - Intronic
1024272800 7:47655295-47655317 CAGAGTCAACAGAAGGAAGACGG + Exonic
1026011993 7:66643656-66643678 CAGAATAATCAGAGGTTTAAGGG - Intronic
1026326756 7:69317219-69317241 AAGAATAAAAAGAAGTTTAATGG - Intergenic
1026672277 7:72400831-72400853 GAGAGTTATCAGAAGTAAAAAGG - Intronic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027597325 7:80190039-80190061 CTGAATATACAGAATTATAAAGG - Intronic
1027611020 7:80360626-80360648 CAGACTGTACAGAAGTATAGTGG - Intergenic
1028515087 7:91669538-91669560 CAAAGTACACAGAAGGATCAGGG - Intergenic
1028820401 7:95204364-95204386 TAGAGGAAACTGAAGAATAAAGG + Intronic
1029503873 7:100950370-100950392 CAGAGAAAAGAGAAGTATAGAGG - Intronic
1030349302 7:108465642-108465664 CACAGGAAATGGAAGTATAAGGG + Intergenic
1033485913 7:141789129-141789151 CAAAGTATCCAGAAATATAAAGG - Intergenic
1033601702 7:142893306-142893328 CAGAGTAAACAGCATTATTTGGG + Intergenic
1034299295 7:150001227-150001249 TAGAGTAACAAGAAGTAGAAAGG - Intergenic
1034648235 7:152667619-152667641 CAGAGTATACTGAATTATAAAGG + Intronic
1034806719 7:154095546-154095568 TAGAGTAACAAGAAGTAGAAAGG + Intronic
1035531924 8:359464-359486 AAGATTAAACACAAGGATAACGG - Intergenic
1036035148 8:5010508-5010530 CAAAGGAAACAGACGGATAAAGG + Intergenic
1036624333 8:10454169-10454191 AAAAGTAAAAATAAGTATAAAGG - Intergenic
1036917736 8:12821027-12821049 CAGAATAAACAGCAGAATAAGGG - Intergenic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1038109921 8:24484697-24484719 CAGAGTAGACTAAAGTAAAATGG + Intronic
1038774609 8:30517351-30517373 CAGAATGAAAAGAAGGATAAGGG - Intronic
1039041871 8:33416151-33416173 CAGAAGAAACAGAAATAAAATGG + Intronic
1041798052 8:61767714-61767736 CAAAGTTAACAGAACTAAAAAGG - Intergenic
1041843731 8:62302755-62302777 CTTAGTAAACAAAAGCATAAGGG + Intronic
1042323133 8:67499256-67499278 CACAGAAACCAGAAGTATCAAGG - Intronic
1042690261 8:71490430-71490452 CGCAATAAACAGAACTATAAAGG + Intronic
1043337896 8:79199682-79199704 CAGAGTCAGAAGAAGGATAATGG - Intergenic
1043803077 8:84636218-84636240 CAGAGCAAATATAAGAATAATGG - Intronic
1044905570 8:96998020-96998042 CAGGATAAGCAGAAGAATAAAGG - Intronic
1046051671 8:109030171-109030193 CAGAGGAAATAGGAGCATAATGG - Intergenic
1046354247 8:113058883-113058905 TACAGTAAAAAGAAGTATACTGG + Intronic
1046615014 8:116466823-116466845 CAGAGTAAACAGAAACAAATTGG + Intergenic
1046923777 8:119764710-119764732 CAAAGTAGAAAGAAGTATAAAGG + Intronic
1048388182 8:133933293-133933315 AAGAGTAAACATCAGGATAAAGG + Intergenic
1048409709 8:134159831-134159853 CACAGAAAACAGAAATATATAGG - Intergenic
1050062449 9:1724133-1724155 CAGGGCAAACAGAGGTATCAGGG - Intergenic
1050275682 9:3996316-3996338 CAGAGAAAACAGAAAAATATGGG + Intronic
1051552538 9:18346091-18346113 CTGAGGAAACAGAAGGCTAATGG - Intergenic
1052167607 9:25352406-25352428 TAGGGAAAACAGAAATATAAGGG - Intergenic
1054836822 9:69684183-69684205 CAGAGTATACAGAAGCCTAAGGG - Intergenic
1055003637 9:71481881-71481903 CAAAGTGAACAGCAATATAAAGG + Intergenic
1055013187 9:71589501-71589523 CTGGGTAAACAGTAATATAAGGG - Intergenic
1055508152 9:76969020-76969042 CAGAGTAAACAAAGGTATTGAGG - Intergenic
1058276682 9:103050305-103050327 CAGATTACACAGAAGTTAAATGG + Intergenic
1058423571 9:104856681-104856703 ATGAGTAAACAGAAGTGAAATGG + Intronic
1058538975 9:105992454-105992476 CAGTGGAAACAGATGTACAATGG - Intergenic
1061736662 9:132665385-132665407 CAGAGGAGACAAAAGTATAAAGG + Intronic
1186410157 X:9339729-9339751 CAGTTTCAACAGAAGCATAAAGG - Intergenic
1186826803 X:13348482-13348504 GAGAGAGAAAAGAAGTATAAGGG + Intergenic
1187948991 X:24453518-24453540 CCAAATAAATAGAAGTATAAAGG + Intergenic
1188281495 X:28275357-28275379 TTGAGTAAACATCAGTATAATGG - Intergenic
1188310902 X:28615473-28615495 CAGTTTAAAAATAAGTATAATGG + Intronic
1188697637 X:33215464-33215486 CAAAGTAAACAGACGAAGAATGG - Intronic
1188779950 X:34269590-34269612 CAGAGTAAAGAGAAAGGTAAAGG + Intergenic
1188999924 X:36933120-36933142 CAGAGTAGCCAGGAGAATAAAGG - Intergenic
1189028560 X:37426430-37426452 TAGAGTAAAGAGAAGTAAAGAGG - Intronic
1189141210 X:38608137-38608159 CAAAGGAAACAGATGTTTAAAGG - Intronic
1189400138 X:40660303-40660325 CAGCATATACAGAAGTAGAATGG - Intronic
1190033119 X:46993524-46993546 CATATCAAACAGAGGTATAACGG - Intronic
1190868470 X:54404930-54404952 CAAAGGAAAGAGAAGTATTAAGG - Intergenic
1191744571 X:64472253-64472275 CAGAATAAACAAATCTATAACGG - Intergenic
1193266324 X:79474461-79474483 AAAAGTAAACAGATGAATAAAGG + Intergenic
1194022328 X:88707245-88707267 CAGAGTCAAGAGAAGAAGAAGGG + Intergenic
1194297993 X:92150946-92150968 CAAACAAAACAGAAGTATAACGG - Intronic
1194338266 X:92676826-92676848 GAGCTGAAACAGAAGTATAACGG - Intergenic
1194595614 X:95853500-95853522 CAAAGTACTCAGAAGAATAAAGG + Intergenic
1195046847 X:101062194-101062216 CCTAGAAACCAGAAGTATAAAGG - Intergenic
1196652634 X:118183913-118183935 CAGAGGAAACAGAGACATAAAGG + Intergenic
1196696063 X:118613320-118613342 CAGTGGCAGCAGAAGTATAAAGG + Intronic
1197063213 X:122207470-122207492 CAGAGTAAATAGTAATACAATGG - Intergenic
1197069021 X:122270905-122270927 CAGAGGAAACAGACGTATTTGGG - Intergenic
1197279444 X:124518038-124518060 CAGAGTTAAGAGAATTATCAAGG + Intronic
1197354479 X:125420088-125420110 AAGAGGACACAAAAGTATAATGG + Intergenic
1198095404 X:133375313-133375335 CATGGTAAAAAGATGTATAAAGG + Intronic
1198143419 X:133829780-133829802 CAGAGCAAAAAGAATTATCAGGG + Intronic
1200326079 X:155240996-155241018 CAGAATACACAGAAATATCAAGG - Intergenic
1200615602 Y:5375917-5375939 CAAACAAAACAGAAGTATAACGG - Intronic
1200646668 Y:5793607-5793629 GAGCTGAAACAGAAGTATAACGG - Intergenic
1201208095 Y:11651944-11651966 CAGAATAGACACAAATATAATGG + Intergenic
1202297023 Y:23369795-23369817 TAGAGTAGACAGTAGGATAAGGG + Intergenic
1202573784 Y:26300802-26300824 TAGAGTAGACAGTAGGATAAGGG - Intergenic