ID: 1123965831

View in Genome Browser
Species Human (GRCh38)
Location 15:25456391-25456413
Sequence ACTCTAGGGTTCAGGCAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1123965823_1123965831 4 Left 1123965823 15:25456364-25456386 CCTCCTCTCTGGGCATGTTCACC No data
Right 1123965831 15:25456391-25456413 ACTCTAGGGTTCAGGCAAGCTGG No data
1123965824_1123965831 1 Left 1123965824 15:25456367-25456389 CCTCTCTGGGCATGTTCACCTCC No data
Right 1123965831 15:25456391-25456413 ACTCTAGGGTTCAGGCAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1123965831 Original CRISPR ACTCTAGGGTTCAGGCAAGC TGG Intergenic